Search result for sequence:
TACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.450462
feces0.421342
adult0.241021
child0.232226
china0.228236
pig0.206600
sus scrofa0.206600
farm0.185090
rural community0.142857
united states of america0.126036
leaf0.115020
obsolete_juvenile stage0.111732
state of michigan0.100000
soil0.099482
canada0.092308
tonsil0.088889
skin0.087912
zoological garden0.084507
control0.083607
city0.081967
river0.080599
india0.065844
belgium0.065306
infant0.062745
female0.061983
plant0.060837
greenhouse0.057143
austria0.051282
captive0.051282
hunter gatherer0.050209
nigeria0.050000
nepal0.050000
jiangsu province0.047059
fresh water0.046512
italy0.045977
rhizosphere0.045558
age 5-13 years0.041929
LOWER IN crohn's disease0.041667
kebbi state0.041494
age 10-15 years0.041494
himalayas0.041494
ivy0.041494
hedera ibernica0.041494
oncorhynchus mykiss0.041494
rainbow trout0.041494
water0.040000
united kingdom0.039448
kingdom of spain0.039062
fish0.038685
caecum0.037360
small village0.033850
venezuela0.033755
amerindian0.033755
colombia0.033661
digestive system0.033501
age 2-4 years0.033473
thailand0.033473
african lion safari0.033473
LOWER IN united states of america0.033473
chuquisaca department0.033473
depth 0-20cm0.033473
mexico0.033195
jiangxi province0.032922
kingdom of norway0.032389
bolivia0.032389
duodenum0.032129
age0.032000
germany0.031621
sweden0.030418
poland0.025478
paddy field soil0.025478
weaned0.025316
age 4-7 weeks0.025316
corn and soybean diet0.025316
age 12-19 weeks0.025316
jordan0.025316
jiulong river0.025316
fujian province0.025316
oslo0.025316
new delhi0.025316
africa0.025316
toronto zoo0.025316
age >940.025316
pre pupae insect diet0.025316
janvier labs0.025316
age 130.025316
cecal content0.025316
agave0.025316
guanajuato0.025316
red soil0.025316
cambisol0.025316
wastewater treatment plant0.025316
french republic0.025210
depth 0.5m0.025000
age 1 year0.025000
brassica0.025000
brassica oleracea0.025000
kingdom of denmark0.025000
tibet autonomous region0.025000
leaf surface0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
pig0.888889
sus scrofa0.888889
rural community0.857143
small village0.750000
hunter gatherer0.750000
tonsil0.666667
nigeria0.666667
venezuela0.666667
amerindian0.666667
LOWER IN obsolete_juvenile stage0.666667
india0.666667
nepal0.666667
age 5-13 years0.666667
LOWER IN nasopharynx0.666667
metabolic syndrome0.666667
poland0.666667
gorilla gorilla0.666667
paddy field soil0.666667
colombia0.600000
river0.583333
belgium0.571429
LOWER IN crohn's disease0.555556
child0.550000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
age 6-10 weeks0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
age 12-19 weeks0.500000
age 8 hours0.500000
age 2-4 years0.500000
anorexia nervosa0.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
jiulong river0.500000
fujian province0.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
oslo0.500000
sudan0.500000
lima0.500000
shantytown0.500000
endospore enriched fraction0.500000
lysis0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN low human contact0.500000
LOWER IN age 2 months0.500000
LOWER IN urinary schistosomiasis0.500000
LOWER IN schistosomiasis0.500000
greenhouse0.500000
musa acuminate0.500000
struvite0.500000
new delhi0.500000
age one year0.500000
salmonella gastroenteritis0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
central african republic0.500000
bangui0.500000
age 1-3 weeks0.500000
koshi river0.500000
tributary0.500000
beaucarnea recurvata0.500000
quito0.500000
toronto zoo0.500000
fruit bat0.500000
eidolon helvum0.500000
raji0.500000
metabolic syndrome x0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
chepang0.500000
dracaena fragrans0.500000
age 19-240.500000
malvaviscus penduliflorus0.500000
age 8-120.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
african lion safari0.500000
indian flying fox0.500000
pteropus giganteus0.500000
age 60-790.500000
LOWER IN united states of america0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.593074
homo sapiens0.545455
china0.216450
adult0.186147
united states of america0.164502
child0.147186
farm0.121212
pig0.116883
sus scrofa0.116883
rural community0.077922
control0.073593
leaf0.073593
soil0.069264
obsolete_juvenile stage0.064935
state of michigan0.060606
skin0.060606
tonsil0.047619
city0.047619
zoological garden0.047619
canada0.047619
river0.043290
female0.038961
infant0.034632
plant0.034632
india0.034632
belgium0.034632
austria0.030303
greenhouse0.030303
captive0.030303
research facility0.030303
italy0.025974
water0.025974
fresh water0.025974
nigeria0.025974
hunter gatherer0.025974
rhizosphere0.025974
nepal0.025974
jiangsu province0.025974
kebbi state0.021645
age 10-15 years0.021645
himalayas0.021645
age 5-13 years0.021645
LOWER IN crohn's disease0.021645
ivy0.021645
hedera ibernica0.021645
kingdom of spain0.021645
fish0.021645
oncorhynchus mykiss0.021645
rainbow trout0.021645
digestive system0.021645
caecum0.021645
united kingdom0.021645
jiangxi province0.017316
age 2-4 years0.017316
colombia0.017316
small village0.017316
kingdom of norway0.017316
venezuela0.017316
amerindian0.017316
germany0.017316
thailand0.017316
african lion safari0.017316
LOWER IN united states of america0.017316
bolivia0.017316
chuquisaca department0.017316
duodenum0.017316
sweden0.017316
age0.017316
mexico0.017316
depth 0-20cm0.017316
weaned0.012987
age 4-7 weeks0.012987
corn and soybean diet0.012987
age 12-19 weeks0.012987
egypt0.012987
LOWER IN control0.012987
jordan0.012987
depth 0.5m0.012987
jiulong river0.012987
fujian province0.012987
oslo0.012987
age 1 year0.012987
monkey0.012987
state of california0.012987
brassica0.012987
brassica oleracea0.012987
new delhi0.012987
kingdom of denmark0.012987
africa0.012987
toronto zoo0.012987
pair of nares0.012987
age >940.012987
pre pupae insect diet0.012987
mouse0.012987
mus musculus0.012987
c57bl/6j0.012987
janvier labs0.012987
age 130.012987
juvenile organism0.012987
cecal content0.012987
Exp. ID User ID Description Date Region Flag Sequences
521amnonhigh freq. in weaned pigs (highfreq pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 14
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 17
564amnonhighfreq control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
564amnonhighfreq autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 20
247amnonhighfreq homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
254amnonhighfreq river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 21
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
509amnon high in control compared to urinary schistosomiasis schistosomiasis in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 35
361amnoncommon leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 37
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 114
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
565amnoncommon bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 122
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
137amnon high in adult compared to juvenile stage in gopherus polyphemus gopher tortoise feces united states of america state of florida 2017-04-17v4No1 / 277
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
565amnoncommon farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
314amnoncommon caecum, cecal content, tibet autonomous region, farm, tibetan pig, tibetan swine, china2018-04-10v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
137amnoncommon gopherus polyphemus, gopher tortoise, feces, united states of america, state of florida2017-04-17v4No1 / 1622
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org