Search result for sequence:
TACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.451478
feces0.417422
adult0.244513
china0.233444
sus scrofa0.220972
pig0.220972
child0.215792
farm0.182137
rural community0.153191
united states of america0.131944
leaf0.122039
obsolete_juvenile stage0.119284
state of michigan0.106464
soil0.105033
tonsil0.095445
city0.087510
river0.086527
control0.080019
india0.070796
infant0.067227
female0.066274
plant0.065041
greenhouse0.061404
belgium0.061404
austria0.054687
hunter gatherer0.054054
nigeria0.053812
nepal0.053812
jiangsu province0.050420
fresh water0.050104
rhizosphere0.048701
LOWER IN crohn's disease0.044843
kebbi state0.044643
age 10-15 years0.044643
himalayas0.044643
ivy0.044643
hedera ibernica0.044643
oncorhynchus mykiss0.044643
rainbow trout0.044643
water0.042629
united kingdom0.042283
kingdom of spain0.041841
fish0.041408
caecum0.040161
skin0.039370
small village0.036474
venezuela0.036364
amerindian0.036364
colombia0.036254
thailand0.036036
LOWER IN united states of america0.036036
chuquisaca department0.036036
age 5-13 years0.036036
depth 0-20cm0.036036
mexico0.035714
zoological garden0.035714
digestive system0.035524
jiangxi province0.035398
kingdom of norway0.034783
bolivia0.034783
duodenum0.034783
age0.034335
germany0.033898
sweden0.032520
poland0.027460
paddy field soil0.027460
corn and soybean diet0.027273
age 4-7 weeks0.027273
weaned0.027273
age 12-19 weeks0.027273
jordan0.027273
depth 0.5m0.027273
jiulong river0.027273
fujian province0.027273
oslo0.027273
new delhi0.027273
africa0.027273
age >940.027273
pre pupae insect diet0.027273
janvier labs0.027273
age 130.027273
cecal content0.027273
french republic0.027273
agave0.027273
guanajuato0.027273
red soil0.027273
cambisol0.027273
wastewater treatment plant0.027273
egypt0.026906
age 1 year0.026906
brassica0.026906
brassica oleracea0.026906
kingdom of denmark0.026906
tibet autonomous region0.026906
leaf surface0.026906
zea mays0.026906
LOWER IN mouth0.026726
monkey0.026549
juvenile organism0.026549
cultivated habitat0.026549
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.888889
pig0.888889
rural community0.857143
small village0.750000
hunter gatherer0.750000
tonsil0.666667
nigeria0.666667
venezuela0.666667
amerindian0.666667
LOWER IN obsolete_juvenile stage0.666667
india0.666667
nepal0.666667
metabolic syndrome0.666667
poland0.666667
gorilla gorilla0.666667
paddy field soil0.666667
colombia0.600000
river0.583333
LOWER IN crohn's disease0.555556
child0.529412
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
age 6-10 weeks0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
age 12-19 weeks0.500000
age 8 hours0.500000
anorexia nervosa0.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
depth 0.5m0.500000
jiulong river0.500000
fujian province0.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
oslo0.500000
sudan0.500000
lima0.500000
shantytown0.500000
endospore enriched fraction0.500000
lysis0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN low human contact0.500000
LOWER IN age 2 months0.500000
LOWER IN schistosomiasis0.500000
LOWER IN urinary schistosomiasis0.500000
greenhouse0.500000
musa acuminate0.500000
struvite0.500000
new delhi0.500000
age one year0.500000
salmonella gastroenteritis0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
central african republic0.500000
bangui0.500000
age 1-3 weeks0.500000
tributary0.500000
koshi river0.500000
beaucarnea recurvata0.500000
belgium0.500000
LOWER IN nasopharynx0.500000
raji0.500000
metabolic syndrome x0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
chepang0.500000
dracaena fragrans0.500000
age 19-240.500000
malvaviscus penduliflorus0.500000
age 8-120.500000
commonwealth of pennsylvania0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
age 60-790.500000
LOWER IN united states of america0.500000
chuquisaca department0.500000
age 5-13 years0.500000
ivy0.500000
hedera ibernica0.500000
scrubland0.500000
moor0.500000
LOWER IN forest0.500000
age 30-500.500000
irritable bowel syndrome0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.607477
homo sapiens0.556075
china0.228972
adult0.191589
united states of america0.177570
child0.135514
sus scrofa0.126168
pig0.126168
farm0.121495
rural community0.084112
leaf0.079439
soil0.074766
obsolete_juvenile stage0.070093
control0.070093
state of michigan0.065421
tonsil0.051402
city0.051402
river0.046729
female0.042056
infant0.037383
plant0.037383
india0.037383
austria0.032710
greenhouse0.032710
belgium0.032710
research facility0.032710
water0.028037
fresh water0.028037
nigeria0.028037
hunter gatherer0.028037
rhizosphere0.028037
nepal0.028037
jiangsu province0.028037
skin0.023364
kebbi state0.023364
age 10-15 years0.023364
himalayas0.023364
LOWER IN crohn's disease0.023364
ivy0.023364
hedera ibernica0.023364
kingdom of spain0.023364
fish0.023364
oncorhynchus mykiss0.023364
rainbow trout0.023364
digestive system0.023364
caecum0.023364
united kingdom0.023364
jiangxi province0.018692
colombia0.018692
small village0.018692
kingdom of norway0.018692
venezuela0.018692
amerindian0.018692
germany0.018692
thailand0.018692
LOWER IN united states of america0.018692
chuquisaca department0.018692
bolivia0.018692
age 5-13 years0.018692
duodenum0.018692
sweden0.018692
age0.018692
mexico0.018692
zoological garden0.018692
depth 0-20cm0.018692
corn and soybean diet0.014019
age 4-7 weeks0.014019
weaned0.014019
age 12-19 weeks0.014019
egypt0.014019
LOWER IN control0.014019
jordan0.014019
depth 0.5m0.014019
jiulong river0.014019
fujian province0.014019
oslo0.014019
age 1 year0.014019
monkey0.014019
state of california0.014019
brassica0.014019
brassica oleracea0.014019
new delhi0.014019
kingdom of denmark0.014019
africa0.014019
age >940.014019
pre pupae insect diet0.014019
janvier labs0.014019
c57bl/6j0.014019
mus musculus0.014019
mouse0.014019
age 130.014019
juvenile organism0.014019
cecal content0.014019
tibet autonomous region0.014019
poland0.014019
french republic0.014019
agave0.014019
desert0.014019
leaf surface0.014019
guanajuato0.014019
Exp. ID User ID Description Date Region Flag Sequences
521amnonhigh freq. in weaned pigs (highfreq corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 9
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 12
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 14
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 17
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
247amnonhighfreq homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
254amnonhighfreq river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-23v4No1 / 21
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 23
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 35
361amnoncommon leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 37
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
534amnoncommon filtered 0.2um, free floating, nepal, tributary, koshi river, depth 10 cm, fresh water, water, river2019-07-22v4No1 / 80
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 114
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
517amnoncommon forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
522amnoncommon high sugar diet, age 18 weeks, janvier labs, c57bl/6j, female, research facility, germany, feces, mus musculus, mouse2019-07-03v3No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
522amnoncommon mouse chow, age 6 weeks, janvier labs, c57bl/6j, female, research facility, germany, feces, mus musculus, mouse2019-07-03v3No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-10v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common suckling, age 2-4 weeks, preweaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated habitat2018-08-21v4No1 / 210
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
137amnon high in adult compared to juvenile stage in gopherus polyphemus gopher tortoise feces florida united states of america 2017-04-17v4No1 / 277
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, china, water, spring)2017-07-12v4No1 / 278
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to forest moor in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 287
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
156amnoncommon brassica, brassica oleracea, china, leaf, phyllosphere2017-07-27v4No1 / 292
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
522amnon high in age 6 weeks mouse chow compared to age 18 weeks high sugar diet in janvier labs c57bl/6j female research facility germany feces mus musculus mouse 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in china soil heavy metal )2017-07-29v4No1 / 337
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
254amnoncommon river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil china hunan province red soil cambisol zea mays triticum aestivum )2018-11-26v4No1 / 395
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, tibetan pig, tibetan swine2018-04-10v4No1 / 467
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in china soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil )2017-12-02v4No1 / 497
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common china, wastewater treatment plant, effluent, spring)2017-07-12v4No1 / 573
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest2017-04-14v4No1 / 693
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, heilongjiang province, ph 5-62018-12-04v4No1 / 726
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity mouth saliva in equus caballus horse canada farm 2018-10-22v4No1 / 791
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, yunnan province2018-12-02v4No1 / 821
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, china, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>52018-11-26v4No1 / 856
412amnon high in ph>5 compared to ph<5 in soil china hunan province red soil cambisol zea mays triticum aestivum 2018-11-26v4No1 / 1005
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in poland river carnivorous beetle beetle whole body 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
421amnoncommon soil, paddy field soil, china, zhejiang province2018-12-04v4No1 / 1194
531amnoncommon cucumber, cucumis sativus, orthic anthrosol, farm, greenhouse soil, china, rhizosphere2019-07-21v3No1 / 1223
40amnoncommon soil, china, field soil, nicotiana tabacum, rhizosphere2016-12-09v4No1 / 1420
137amnoncommon gopherus polyphemus, gopher tortoise, feces, florida, united states of america2017-04-17v4No1 / 1622
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
175amnoncommon in heavy metal contaminated soils in china (common china, soil, heavy metal, ph 7-9)2017-07-29v4No1 / 2133
296amnoncommon china, soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>82018-02-11v4No1 / 2646
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
296amnoncommon china, soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<62018-02-11v4No1 / 3508
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559
271amnon high in soil compared to rhizosphere glycine max soybean in china depth 0-20cm 2018-01-09v4No1 / 4853
271amnon high in soil rhizosphere compared to root root structure in china depth 0-20cm glycine max soybean 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org