Search result for sequence:
TACGTAGGTGGCGAGCGTTGTTCGGATTTATTGGGCGTAAAGGGTCTGTAGGAGGTTCGTTAAATACGAGGTGAAATCCCGAAGCTCAACTTCGGAACTGCCTTGTAGACTGACGGACTAGAGTACCGGAGAGGTAAGCGGAATACCAGG
common ontology terms
term enrichment score
TermScore
adult0.207547
gallus gallus0.193548
chicken0.193548
homo sapiens0.170479
thailand0.160000
feces0.156629
kingdom of spain0.155844
free range chicken0.153846
low bmi0.142857
LOWER IN child0.142857
kingdom of denmark0.142857
LOWER IN high bmi0.137931
czech republic0.137931
infant0.100000
mongolian sheep0.083333
cecum0.083333
estonia0.083333
LOWER IN russia0.083333
toronto0.083333
nanchang city prefecture0.083333
LOWER IN pancreatitis0.083333
LOWER IN acute pancreatitis0.083333
LOWER IN nepal0.083333
LOWER IN himalayas0.083333
LOWER IN short bowel syndrome0.083333
cron diet0.083333
age >940.083333
LOWER IN age 30-500.083333
LOWER IN age 60-790.083333
age 30-500.083333
age 60-790.083333
LOWER IN age 3-60.083333
LOWER IN age 8-120.083333
age one year0.083333
LOWER IN age one month0.083333
africa0.083333
central african republic0.083333
LOWER IN madagascar0.083333
bangui0.083333
LOWER IN antananarivo0.083333
venezuela0.080000
amerindian0.080000
LOWER IN obsolete_juvenile stage0.080000
LOWER IN systemic lupus erythematosus0.080000
LOWER IN sweden0.080000
male0.080000
age < 3 years0.080000
age 8 weeks0.080000
age 6 weeks0.080000
wistar rat0.080000
metabolic syndrome0.080000
caloric restriction diet0.080000
LOWER IN american diet0.080000
hunter gatherer0.076923
gay0.076923
broiler chicken0.076923
LOWER IN infant0.074074
commonwealth of virginia0.074074
homosexual0.074074
msm0.074074
LOWER IN rural community0.074074
body mass index0.074074
ovis aries0.071429
rattus0.071429
ileum0.066667
hiv infection0.066667
rectum0.064516
united kingdom0.064516
LOWER IN crohn's disease0.064516
caecum0.060606
rat0.058824
farm0.058824
china0.055814
control0.052980
colon0.048780
age0.048780
child0.047619
diet0.043478
united states of america0.038278
research facility0.016807
Fraction of dbbact annotations with this term covered by the query
TermScore
thailand0.666667
mongolian sheep0.500000
cecum0.500000
estonia0.500000
LOWER IN russia0.500000
free range chicken0.500000
toronto0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN short bowel syndrome0.500000
cron diet0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
age one year0.500000
LOWER IN age one month0.500000
africa0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
venezuela0.333333
amerindian0.333333
LOWER IN obsolete_juvenile stage0.333333
LOWER IN systemic lupus erythematosus0.333333
low bmi0.333333
LOWER IN sweden0.333333
male0.333333
age < 3 years0.333333
gallus gallus0.333333
chicken0.333333
age 8 weeks0.333333
LOWER IN child0.333333
age 6 weeks0.333333
wistar rat0.333333
kingdom of denmark0.333333
metabolic syndrome0.333333
caloric restriction diet0.333333
LOWER IN american diet0.333333
LOWER IN high bmi0.285714
czech republic0.285714
hunter gatherer0.250000
gay0.250000
broiler chicken0.250000
LOWER IN infant0.200000
commonwealth of virginia0.200000
homosexual0.200000
msm0.200000
LOWER IN rural community0.200000
body mass index0.200000
kingdom of spain0.181818
ovis aries0.166667
rattus0.166667
adult0.130952
ileum0.125000
hiv infection0.125000
rectum0.111111
infant0.111111
united kingdom0.111111
LOWER IN crohn's disease0.111111
homo sapiens0.095808
feces0.086124
rat0.083333
colon0.052632
age0.052632
child0.050000
caecum0.045455
farm0.043478
diet0.041667
china0.032967
control0.031008
united states of america0.021390
research facility0.010309
Fraction of annotations for the query sequences containing the term
TermScore
feces0.863636
homo sapiens0.772727
adult0.500000
china0.181818
united states of america0.181818
control0.181818
kingdom of spain0.136364
gallus gallus0.136364
chicken0.136364
thailand0.090909
low bmi0.090909
LOWER IN high bmi0.090909
infant0.090909
caecum0.090909
farm0.090909
free range chicken0.090909
LOWER IN child0.090909
czech republic0.090909
kingdom of denmark0.090909
mongolian sheep0.045455
ovis aries0.045455
rectum0.045455
ileum0.045455
cecum0.045455
colon0.045455
venezuela0.045455
hunter gatherer0.045455
amerindian0.045455
LOWER IN infant0.045455
LOWER IN obsolete_juvenile stage0.045455
commonwealth of virginia0.045455
LOWER IN systemic lupus erythematosus0.045455
LOWER IN sweden0.045455
homosexual0.045455
gay0.045455
msm0.045455
male0.045455
hiv infection0.045455
age < 3 years0.045455
estonia0.045455
LOWER IN russia0.045455
age 8 weeks0.045455
toronto0.045455
nanchang city prefecture0.045455
LOWER IN pancreatitis0.045455
LOWER IN acute pancreatitis0.045455
age 6 weeks0.045455
LOWER IN nepal0.045455
LOWER IN himalayas0.045455
LOWER IN rural community0.045455
rattus0.045455
rat0.045455
research facility0.045455
wistar rat0.045455
broiler chicken0.045455
metabolic syndrome0.045455
LOWER IN short bowel syndrome0.045455
body mass index0.045455
united kingdom0.045455
cron diet0.045455
caloric restriction diet0.045455
LOWER IN american diet0.045455
diet0.045455
LOWER IN crohn's disease0.045455
age >940.045455
LOWER IN age 30-500.045455
LOWER IN age 60-790.045455
age 30-500.045455
age 60-790.045455
LOWER IN age 3-60.045455
LOWER IN age 8-120.045455
age0.045455
age one year0.045455
LOWER IN age one month0.045455
africa0.045455
child0.045455
central african republic0.045455
LOWER IN madagascar0.045455
bangui0.045455
LOWER IN antananarivo0.045455
Exp. ID User ID Description Date Region Flag Sequences
111amnonhighfreq mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
578amnon high in kingdom of spain compared to sweden in homosexual gay msm male adult hiv infection feces homo sapiens 2020-01-14v3No1 / 133
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
568amnoncommon thailand, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 320
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564

Problems / suggestions? Please email info AT dbbact DOT org