Search result for sequence:
TACGTAGGTGGCGAGCGTTGTTCGGATTTATTGGGCGTAAAGGGTCTGTAGGAGGTTCGTTAAATACGAGGTGAAATCCCGAAGCTCAACTTCGGAACTGCCTTGTAGACTGACGGACTAGAGTACCGGAGAGGTAAGCGGAATACCAGG
common ontology terms
term enrichment score
TermScore
adult0.195122
homo sapiens0.175881
feces0.166757
gallus gallus0.162162
chicken0.162162
thailand0.137931
free range chicken0.137931
kingdom of spain0.134831
low bmi0.129032
LOWER IN high bmi0.125000
LOWER IN child0.125000
czech republic0.125000
kingdom of denmark0.125000
caecum0.121212
infant0.090909
mongolian sheep0.074074
cecum0.074074
rem sleep behavior disorder0.074074
cameroon0.074074
yaounde0.074074
estonia0.074074
LOWER IN russia0.074074
toronto0.074074
nanchang city prefecture0.074074
LOWER IN pancreatitis0.074074
LOWER IN acute pancreatitis0.074074
LOWER IN nepal0.074074
LOWER IN himalayas0.074074
LOWER IN short bowel syndrome0.074074
cron diet0.074074
age >940.074074
LOWER IN age 30-500.074074
LOWER IN age 60-790.074074
age 30-500.074074
age 60-790.074074
LOWER IN age 3-60.074074
LOWER IN age 8-120.074074
age one year0.074074
LOWER IN age one month0.074074
central african republic0.074074
LOWER IN madagascar0.074074
bangui0.074074
LOWER IN antananarivo0.074074
LOWER IN nouabale-ndoki national park0.074074
LOWER IN republic of congo0.074074
LOWER IN pan troglodytes troglodytes0.074074
venezuela0.071429
amerindian0.071429
LOWER IN obsolete_juvenile stage0.071429
LOWER IN systemic lupus erythematosus0.071429
LOWER IN sweden0.071429
age < 3 years0.071429
age 8 weeks0.071429
age 6 weeks0.071429
wistar rat0.071429
metabolic syndrome0.071429
caloric restriction diet0.071429
LOWER IN american diet0.071429
africa0.071429
hunter gatherer0.068966
gay0.068966
broiler chicken0.068966
pan troglodytes0.068966
chimpanzee0.068966
LOWER IN infant0.066667
commonwealth of virginia0.066667
body mass index0.066667
msm0.064516
homosexual0.064516
LOWER IN rural community0.064516
rattus0.064516
ovis aries0.062500
ileum0.058824
hiv infection0.058824
male0.058824
united kingdom0.058824
LOWER IN crohn&#39;s disease0.058824
rectum0.057143
LOWER IN wild0.057143
zoological garden0.057143
germany0.052632
rat0.051282
farm0.049383
control0.048193
china0.048096
city0.046512
colon0.045455
age0.045455
united states of america0.044444
child0.041667
diet0.040816
research facility0.015038
Fraction of dbbact annotations with this term covered by the query
TermScore
mongolian sheep0.500000
cecum0.500000
thailand0.500000
rem sleep behavior disorder0.500000
cameroon0.500000
yaounde0.500000
estonia0.500000
LOWER IN russia0.500000
free range chicken0.500000
toronto0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN short bowel syndrome0.500000
cron diet0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
venezuela0.333333
amerindian0.333333
LOWER IN obsolete_juvenile stage0.333333
LOWER IN systemic lupus erythematosus0.333333
low bmi0.333333
LOWER IN sweden0.333333
age < 3 years0.333333
age 8 weeks0.333333
age 6 weeks0.333333
wistar rat0.333333
metabolic syndrome0.333333
caloric restriction diet0.333333
LOWER IN american diet0.333333
africa0.333333
LOWER IN high bmi0.285714
LOWER IN child0.285714
czech republic0.285714
kingdom of denmark0.285714
hunter gatherer0.250000
gay0.250000
gallus gallus0.250000
chicken0.250000
caecum0.250000
broiler chicken0.250000
pan troglodytes0.250000
chimpanzee0.250000
LOWER IN infant0.200000
commonwealth of virginia0.200000
body mass index0.200000
msm0.166667
homosexual0.166667
LOWER IN rural community0.166667
rattus0.166667
kingdom of spain0.153846
ovis aries0.142857
adult0.122449
ileum0.111111
hiv infection0.111111
male0.111111
united kingdom0.111111
LOWER IN crohn&#39;s disease0.111111
infant0.105263
rectum0.100000
LOWER IN wild0.100000
zoological garden0.100000
homo sapiens0.099448
feces0.092105
germany0.076923
rat0.071429
city0.055556
colon0.052632
age0.052632
child0.043478
diet0.041667
farm0.035714
control0.028369
china0.028302
united states of america0.025000
research facility0.009259
Fraction of annotations for the query sequences containing the term
TermScore
feces0.880000
homo sapiens0.760000
adult0.480000
united states of america0.200000
china0.160000
control0.160000
kingdom of spain0.120000
gallus gallus0.120000
chicken0.120000
thailand0.080000
low bmi0.080000
LOWER IN high bmi0.080000
infant0.080000
caecum0.080000
farm0.080000
free range chicken0.080000
LOWER IN child0.080000
czech republic0.080000
kingdom of denmark0.080000
mongolian sheep0.040000
ovis aries0.040000
rectum0.040000
ileum0.040000
cecum0.040000
colon0.040000
venezuela0.040000
hunter gatherer0.040000
amerindian0.040000
LOWER IN infant0.040000
LOWER IN obsolete_juvenile stage0.040000
commonwealth of virginia0.040000
LOWER IN systemic lupus erythematosus0.040000
hiv infection0.040000
male0.040000
msm0.040000
gay0.040000
homosexual0.040000
LOWER IN sweden0.040000
germany0.040000
rem sleep behavior disorder0.040000
cameroon0.040000
city0.040000
yaounde0.040000
age < 3 years0.040000
estonia0.040000
LOWER IN russia0.040000
age 8 weeks0.040000
toronto0.040000
nanchang city prefecture0.040000
LOWER IN pancreatitis0.040000
LOWER IN acute pancreatitis0.040000
age 6 weeks0.040000
LOWER IN nepal0.040000
LOWER IN himalayas0.040000
LOWER IN rural community0.040000
rattus0.040000
rat0.040000
research facility0.040000
wistar rat0.040000
broiler chicken0.040000
metabolic syndrome0.040000
LOWER IN short bowel syndrome0.040000
body mass index0.040000
united kingdom0.040000
cron diet0.040000
caloric restriction diet0.040000
LOWER IN american diet0.040000
diet0.040000
LOWER IN crohn&#39;s disease0.040000
age >940.040000
LOWER IN age 30-500.040000
LOWER IN age 60-790.040000
age 30-500.040000
age 60-790.040000
LOWER IN age 3-60.040000
LOWER IN age 8-120.040000
age0.040000
age one year0.040000
LOWER IN age one month0.040000
africa0.040000
child0.040000
central african republic0.040000
LOWER IN madagascar0.040000
bangui0.040000
LOWER IN antananarivo0.040000
LOWER IN nouabale-ndoki national park0.040000
LOWER IN republic of congo0.040000
LOWER IN wild0.040000
LOWER IN pan troglodytes troglodytes0.040000
zoological garden0.040000
pan troglodytes0.040000
chimpanzee0.040000
Exp. ID User ID Description Date Region Flag Sequences
111amnondominant mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964

Problems / suggestions? Please email info AT dbbact DOT org