Search result for sequence:
TACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCATGGGCTCAACCCATGAACTGCTCTCAAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.373437
feces0.368286
adult0.303448
rural community0.207254
pig0.194444
sus scrofa0.194444
child0.172662
monkey0.132964
china0.126150
zoological garden0.118980
united kingdom0.116667
control0.114911
farm0.106707
united states of america0.096569
age 5-13 years0.093897
LOWER IN crohn's disease0.092593
caecum0.090909
colombia0.075710
thailand0.074766
chuquisaca department0.074766
city0.070671
bolivia0.069565
state of tennessee0.067227
skin0.064516
hunter gatherer0.058252
tibet autonomous region0.057971
age 50-60 years0.057143
nanning city prefecture0.057143
low bmi0.057143
small village0.057143
zambia0.057143
LOWER IN high bmi0.056604
LOWER IN ulcerative colitis0.056604
state of michigan0.054795
kingdom of norway0.054054
ethiopia0.054054
kingdom of spain0.052632
wild0.051282
female0.045455
canada0.039604
tonsil0.039216
amerindian0.039216
venezuela0.039216
gorilla gorilla0.039216
nephrolithiasis0.038835
himalayas0.038835
age 60-790.038835
age >940.038835
oslo0.038835
age 30-400.038835
myanmar0.038835
karen0.038835
cron diet0.038835
kebbi state0.038835
age 10-15 years0.038835
LOWER IN age 3-60.038835
tunapuco0.038835
cecal content0.038835
africa0.038835
chlorocebus aethiops0.038835
LOWER IN mouth mucosa0.038835
LOWER IN infant0.038462
nepal0.038095
LOWER IN child0.038095
kingdom of denmark0.038095
caloric restriction diet0.038095
nigeria0.038095
peru0.038095
papio anubis0.038095
jiangsu province0.037383
LOWER IN ileum0.037383
LOWER IN united states of america0.037383
ileum0.037383
LOWER IN duodenum0.037383
left colon0.037383
rectum0.037037
right colon0.036697
LOWER IN mouth0.035398
fresh water0.034188
colon0.033898
obsolete_juvenile stage0.033613
diet0.032520
water0.027586
new york county0.019802
LOWER IN chronic fatigue syndrome0.019802
quito0.019802
raji0.019802
chepang0.019802
lima0.019802
shantytown0.019802
age 12-19 weeks0.019802
LOWER IN irritable bowel syndrome0.019802
toronto0.019802
glasgow0.019802
LOWER IN age one month0.019802
physical activity0.019802
LOWER IN little physical activity0.019802
urinary schistosomiasis0.019802
schistosomiasis0.019802
el salvador0.019802
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
pig0.777778
sus scrofa0.777778
hunter gatherer0.750000
rural community0.714286
tibet autonomous region0.666667
tonsil0.666667
age 5-13 years0.666667
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
colombia0.600000
LOWER IN crohn's disease0.555556
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
thailand0.500000
low bmi0.500000
quito0.500000
himalayas0.500000
raji0.500000
chepang0.500000
lima0.500000
shantytown0.500000
age 60-790.500000
chuquisaca department0.500000
age 12-19 weeks0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
toronto0.500000
glasgow0.500000
LOWER IN age one month0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
el salvador0.500000
small village0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
hadza0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
atherosclerosis0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
sucram0.500000
LOWER IN standard feed0.500000
gorilla0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN hmong0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
cecal content0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
sigmoid colon0.500000
children0.500000
mongolian sheep0.500000
tibetan pig0.500000
tibetan swine0.500000
LOWER IN state of oklahoma0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
central african republic0.500000
LOWER IN madagascar0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.818182
homo sapiens0.676768
adult0.333333
united states of america0.191919
china0.161616
control0.141414
child0.121212
rural community0.121212
pig0.111111
sus scrofa0.111111
monkey0.080808
farm0.070707
united kingdom0.070707
zoological garden0.070707
caecum0.060606
city0.050505
age 5-13 years0.050505
LOWER IN crohn's disease0.050505
thailand0.040404
skin0.040404
colombia0.040404
bolivia0.040404
chuquisaca department0.040404
state of tennessee0.040404
age 50-60 years0.030303
nanning city prefecture0.030303
tibet autonomous region0.030303
low bmi0.030303
LOWER IN high bmi0.030303
state of michigan0.030303
LOWER IN ulcerative colitis0.030303
kingdom of spain0.030303
hunter gatherer0.030303
kingdom of norway0.030303
female0.030303
small village0.030303
zambia0.030303
wild0.030303
ethiopia0.030303
nephrolithiasis0.020202
tonsil0.020202
himalayas0.020202
nepal0.020202
age 60-790.020202
jiangsu province0.020202
amerindian0.020202
venezuela0.020202
age >940.020202
LOWER IN child0.020202
kingdom of denmark0.020202
oslo0.020202
age 30-400.020202
myanmar0.020202
karen0.020202
cron diet0.020202
caloric restriction diet0.020202
LOWER IN infant0.020202
nigeria0.020202
kebbi state0.020202
age 10-15 years0.020202
LOWER IN age 3-60.020202
LOWER IN ileum0.020202
canada0.020202
diet0.020202
gorilla gorilla0.020202
peru0.020202
tunapuco0.020202
papio anubis0.020202
obsolete_juvenile stage0.020202
LOWER IN united states of america0.020202
ileum0.020202
cecal content0.020202
africa0.020202
LOWER IN duodenum0.020202
chlorocebus aethiops0.020202
rectum0.020202
colon0.020202
right colon0.020202
left colon0.020202
water0.020202
fresh water0.020202
LOWER IN mouth mucosa0.020202
LOWER IN mouth0.020202
new york county0.010101
LOWER IN chronic fatigue syndrome0.010101
LOWER IN control0.010101
tibetan plateau0.010101
age 4 weeks0.010101
state of california0.010101
nipple0.010101
ecuador0.010101
quito0.010101
lean body mass0.010101
raji0.010101
forager0.010101
chepang0.010101
lima0.010101
shantytown0.010101
age 12-19 weeks0.010101
LOWER IN irritable bowel syndrome0.010101
Exp. ID User ID Description Date Region Flag Sequences
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 54
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
314amnoncommon caecum, cecal content, tibet autonomous region, farm, tibetan pig, tibetan swine, china2018-04-10v4No1 / 467
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org