Search result for sequence:
TACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCATGGGCTCAACCCATGAACTGCTCTCAAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.383164
feces0.365833
adult0.305108
rural community0.210896
pig0.197943
sus scrofa0.197943
child0.163690
monkey0.135211
zoological garden0.128834
control0.119318
united kingdom0.118644
china0.117878
farm0.109546
united states of america0.099066
LOWER IN crohn's disease0.094340
caecum0.093385
colombia0.077170
thailand0.076190
chuquisaca department0.076190
age 5-13 years0.076190
city0.071685
bolivia0.070796
state of tennessee0.068376
skin0.066116
hunter gatherer0.059406
tibet autonomous region0.059113
age 50-60 years0.058252
nanning city prefecture0.058252
low bmi0.058252
small village0.058252
zambia0.058252
LOWER IN high bmi0.057692
LOWER IN ulcerative colitis0.057692
state of michigan0.055814
kingdom of norway0.055046
ethiopia0.055046
kingdom of spain0.053571
wild0.052174
female0.046512
tonsil0.040000
amerindian0.040000
venezuela0.040000
gorilla gorilla0.040000
nephrolithiasis0.039604
himalayas0.039604
age 60-790.039604
age >940.039604
oslo0.039604
age 30-400.039604
myanmar0.039604
karen0.039604
cron diet0.039604
kebbi state0.039604
age 10-15 years0.039604
LOWER IN age 3-60.039604
tunapuco0.039604
papio anubis0.039604
cecal content0.039604
africa0.039604
chlorocebus aethiops0.039604
LOWER IN mouth mucosa0.039604
LOWER IN infant0.039216
nepal0.038835
LOWER IN child0.038835
kingdom of denmark0.038835
caloric restriction diet0.038835
nigeria0.038835
peru0.038835
LOWER IN duodenum0.038462
jiangsu province0.038095
LOWER IN ileum0.038095
LOWER IN united states of america0.038095
ileum0.038095
left colon0.038095
rectum0.037736
right colon0.037383
canada0.036036
LOWER IN mouth0.036036
fresh water0.035088
colon0.034783
obsolete_juvenile stage0.034188
diet0.033333
water0.028169
new york county0.020202
LOWER IN chronic fatigue syndrome0.020202
raji0.020202
chepang0.020202
lima0.020202
shantytown0.020202
age 12-19 weeks0.020202
LOWER IN irritable bowel syndrome0.020202
toronto0.020202
glasgow0.020202
LOWER IN age one month0.020202
physical activity0.020202
LOWER IN little physical activity0.020202
schistosomiasis0.020202
urinary schistosomiasis0.020202
el salvador0.020202
age 8-120.020202
Fraction of dbbact annotations with this term covered by the query
TermScore
pig0.777778
sus scrofa0.777778
hunter gatherer0.750000
rural community0.714286
tibet autonomous region0.666667
tonsil0.666667
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
colombia0.600000
zoological garden0.600000
LOWER IN crohn's disease0.555556
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
thailand0.500000
low bmi0.500000
himalayas0.500000
raji0.500000
chepang0.500000
lima0.500000
shantytown0.500000
age 60-790.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 12-19 weeks0.500000
LOWER IN irritable bowel syndrome0.500000
age >940.500000
toronto0.500000
glasgow0.500000
LOWER IN age one month0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
kebbi state0.500000
age 10-15 years0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
el salvador0.500000
small village0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
hadza0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
atherosclerosis0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
sucram0.500000
LOWER IN standard feed0.500000
gorilla0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
bangladesh0.500000
tunapuco0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
papio anubis0.500000
olive baboon0.500000
LOWER IN hmong0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
cecal content0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
sigmoid colon0.500000
children0.500000
mongolian sheep0.500000
tibetan pig0.500000
tibetan swine0.500000
LOWER IN state of oklahoma0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 30-500.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
central african republic0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.814433
homo sapiens0.680412
adult0.329897
united states of america0.195876
china0.154639
control0.144330
rural community0.123711
pig0.113402
sus scrofa0.113402
child0.113402
monkey0.082474
farm0.072165
united kingdom0.072165
zoological garden0.072165
caecum0.061856
city0.051546
LOWER IN crohn's disease0.051546
thailand0.041237
skin0.041237
colombia0.041237
chuquisaca department0.041237
bolivia0.041237
age 5-13 years0.041237
state of tennessee0.041237
age 50-60 years0.030928
nanning city prefecture0.030928
tibet autonomous region0.030928
low bmi0.030928
LOWER IN high bmi0.030928
state of michigan0.030928
LOWER IN ulcerative colitis0.030928
kingdom of spain0.030928
hunter gatherer0.030928
kingdom of norway0.030928
female0.030928
small village0.030928
zambia0.030928
wild0.030928
ethiopia0.030928
nephrolithiasis0.020619
tonsil0.020619
himalayas0.020619
nepal0.020619
age 60-790.020619
jiangsu province0.020619
amerindian0.020619
venezuela0.020619
age >940.020619
LOWER IN child0.020619
kingdom of denmark0.020619
oslo0.020619
age 30-400.020619
myanmar0.020619
karen0.020619
cron diet0.020619
caloric restriction diet0.020619
LOWER IN infant0.020619
nigeria0.020619
kebbi state0.020619
age 10-15 years0.020619
LOWER IN age 3-60.020619
LOWER IN ileum0.020619
canada0.020619
diet0.020619
gorilla gorilla0.020619
peru0.020619
tunapuco0.020619
papio anubis0.020619
obsolete_juvenile stage0.020619
LOWER IN united states of america0.020619
ileum0.020619
cecal content0.020619
africa0.020619
LOWER IN duodenum0.020619
chlorocebus aethiops0.020619
rectum0.020619
colon0.020619
right colon0.020619
left colon0.020619
water0.020619
fresh water0.020619
LOWER IN mouth mucosa0.020619
LOWER IN mouth0.020619
new york county0.010309
LOWER IN chronic fatigue syndrome0.010309
LOWER IN control0.010309
tibetan plateau0.010309
age 4 weeks0.010309
state of california0.010309
nipple0.010309
lean body mass0.010309
raji0.010309
forager0.010309
chepang0.010309
lima0.010309
shantytown0.010309
age 12-19 weeks0.010309
LOWER IN irritable bowel syndrome0.010309
toronto0.010309
LOWER IN adult0.010309
Exp. ID User ID Description Date Region Flag Sequences
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-27v4No1 / 54
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig united kingdom gastrointestinal system )2017-11-26v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, tibetan pig, tibetan swine2018-04-10v4No1 / 467
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in beetle whole body 2019-04-19v4No1 / 1543
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult united kingdom skin cambridgeshire lissotriton vulgaris )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org