Search result for sequence:
TACGTAGGTTGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCATGGGCTCAACCCATGAACTGCTTCCAAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
rural community0.358314
zoological garden0.237288
feces0.222205
homo sapiens0.209125
adult0.190045
monkey0.169811
hunter gatherer0.142857
city0.128146
macaca mulatta0.127660
child0.125714
small village0.120968
chimpanzee0.120968
pan troglodytes0.120968
rhesus macaque0.116279
LOWER IN united states of america0.116279
venezuela0.097561
amerindian0.097561
tanzania0.095238
chuquisaca department0.095238
captive0.094488
united states of america0.092685
age 5-13 years0.090909
bolivia0.086957
age 8 months0.073171
himalayas0.073171
africa0.073171
LOWER IN city0.072289
nepal0.070588
gorilla gorilla0.070588
LOWER IN child0.068182
thailand0.063830
LOWER IN wild0.062827
obsolete_juvenile stage0.056604
female0.050847
village0.050633
LOWER IN pan troglodytes troglodytes0.050633
LOWER IN state of oregon0.050000
chepang0.050000
pemba island0.050000
myanmar0.050000
karen0.050000
kebbi state0.050000
el salvador0.050000
hadza0.050000
age 50-60 years0.050000
nanning city prefecture0.050000
como zoo0.050000
tunapuco0.050000
europe0.050000
pan troglodytes verus0.050000
lincoln park zoo0.050000
saint louis zoo0.050000
saint louis0.050000
age 60-790.050000
LOWER IN nouabale-ndoki national park0.050000
LOWER IN republic of congo0.050000
hispanic or latin american0.048780
forager0.048780
cameroon0.048780
south america0.048780
papio anubis0.048780
chicago0.048780
age 30-500.048780
nigeria0.047619
age 10-15 years0.047619
peru0.047619
LOWER IN infant0.047059
state of tennessee0.046512
egypt0.045455
LOWER IN mouth mucosa0.045455
state of minnesota0.044444
LOWER IN mouth0.044444
control0.040323
china0.038898
state of california0.032258
high filber0.025641
LOWER IN low fiber0.025641
LOWER IN tharu0.025641
LOWER IN agrarian0.025641
LOWER IN antiretroviral therapy0.025641
municipality of logrono0.025641
LOWER IN human immunodeficiency virus infectious disease0.025641
shuar population0.025641
ngoantet0.025641
LOWER IN cuba0.025641
urinary schistosomiasis0.025641
schistosomiasis0.025641
yaounde0.025641
low income0.025641
LOWER IN sewer0.025641
nouabale-ndoki national park0.025641
republic of congo0.025641
nephrolithiasis0.025641
black-handed spider monkey0.025641
ateles geoffroyi0.025641
LOWER IN pancreatitis0.025641
LOWER IN acute pancreatitis0.025641
LOWER IN lima0.025641
LOWER IN shantytown0.025641
LOWER IN hmong0.025641
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
small village0.750000
hunter gatherer0.750000
chimpanzee0.750000
pan troglodytes0.750000
venezuela0.666667
amerindian0.666667
village0.666667
LOWER IN pan troglodytes troglodytes0.666667
high filber0.500000
LOWER IN low fiber0.500000
LOWER IN state of oregon0.500000
age 8 months0.500000
rhesus macaque0.500000
himalayas0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
tanzania0.500000
pemba island0.500000
LOWER IN united states of america0.500000
LOWER IN antiretroviral therapy0.500000
municipality of logrono0.500000
LOWER IN human immunodeficiency virus infectious disease0.500000
chuquisaca department0.500000
shuar population0.500000
africa0.500000
myanmar0.500000
karen0.500000
ngoantet0.500000
LOWER IN cuba0.500000
kebbi state0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
yaounde0.500000
el salvador0.500000
hadza0.500000
low income0.500000
LOWER IN sewer0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
como zoo0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN hmong0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
europe0.500000
pan troglodytes verus0.500000
western chimpanzee0.500000
lincoln park zoo0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
cron diet0.500000
saint louis zoo0.500000
saint louis0.500000
sewage0.500000
LOWER IN effluent0.500000
LOWER IN state of oklahoma0.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN age 6 months0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
LOWER IN city0.428571
hispanic or latin american0.333333
plant fiber cell0.333333
LOWER IN obsolete_juvenile stage0.333333
tibet autonomous region0.333333
macaca mulatta0.333333
nepal0.333333
forager0.333333
estonia0.333333
LOWER IN age 1-3 years0.333333
age 5-13 years0.333333
cameroon0.333333
south america0.333333
LOWER IN wastewater treatment plant0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.973684
homo sapiens0.710526
adult0.368421
united states of america0.328947
rural community0.223684
zoological garden0.184211
child0.144737
monkey0.118421
city0.092105
china0.078947
hunter gatherer0.078947
macaca mulatta0.078947
research facility0.078947
captive0.078947
small village0.065789
rhesus macaque0.065789
LOWER IN united states of america0.065789
control0.065789
chimpanzee0.065789
pan troglodytes0.065789
venezuela0.052632
amerindian0.052632
female0.052632
tanzania0.052632
age 5-13 years0.052632
bolivia0.052632
chuquisaca department0.052632
LOWER IN city0.039474
age 8 months0.039474
himalayas0.039474
nepal0.039474
LOWER IN child0.039474
africa0.039474
thailand0.039474
obsolete_juvenile stage0.039474
LOWER IN wild0.039474
gorilla gorilla0.039474
hispanic or latin american0.026316
LOWER IN infant0.026316
LOWER IN state of oregon0.026316
state of california0.026316
chepang0.026316
forager0.026316
pemba island0.026316
village0.026316
myanmar0.026316
karen0.026316
cameroon0.026316
egypt0.026316
nigeria0.026316
kebbi state0.026316
age 10-15 years0.026316
el salvador0.026316
hadza0.026316
south america0.026316
age 50-60 years0.026316
nanning city prefecture0.026316
state of minnesota0.026316
como zoo0.026316
peru0.026316
tunapuco0.026316
papio anubis0.026316
LOWER IN pan troglodytes troglodytes0.026316
europe0.026316
pan troglodytes verus0.026316
lincoln park zoo0.026316
chicago0.026316
state of tennessee0.026316
saint louis zoo0.026316
saint louis0.026316
age 30-500.026316
age 60-790.026316
LOWER IN mouth mucosa0.026316
LOWER IN mouth0.026316
LOWER IN nouabale-ndoki national park0.026316
LOWER IN republic of congo0.026316
LOWER IN old age0.013158
young age0.013158
colombia0.013158
plant fiber cell0.013158
high filber0.013158
LOWER IN low fiber0.013158
LOWER IN obsolete_juvenile stage0.013158
tibet autonomous region0.013158
tibetan plateau0.013158
LOWER IN tharu0.013158
LOWER IN agrarian0.013158
hiv infection0.013158
LOWER IN control0.013158
LOWER IN control diet0.013158
ketogenic diet0.013158
obesity0.013158
high bmi0.013158
estonia0.013158
LOWER IN age 1-3 years0.013158
LOWER IN antiretroviral therapy0.013158
municipality of logrono0.013158
kingdom of spain0.013158
LOWER IN human immunodeficiency virus infectious disease0.013158
LOWER IN hiv infection0.013158
Exp. ID User ID Description Date Region Flag Sequences
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 5
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 22
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 66
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
592amnoncommon wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v1No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
729amnoncommon western chimpanzee, pan troglodytes verus, europe, zoological garden, feces, monkey2021-01-05v3No1 / 343
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org