Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCCTGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.571897
feces0.451163
adult0.394644
united states of america0.203781
child0.177829
city0.159574
control0.103834
china0.096070
obsolete_juvenile stage0.087977
infant0.083682
biopsy0.077170
LOWER IN crohn's disease0.075472
rural community0.072072
age0.068966
female0.066519
metabolic syndrome0.059113
state of oklahoma0.059113
biopsy site0.058252
zambia0.058252
india0.058252
chuquisaca department0.058252
age 5-13 years0.058252
kingdom of denmark0.056604
rectum0.056604
LOWER IN ulcerative colitis0.055814
state of colorado0.055814
finland0.055814
jiangsu province0.055046
kingdom of norway0.055046
bolivia0.055046
united kingdom0.054299
monkey0.049587
kingdom of spain0.047244
wild0.045113
homosexual0.040000
gay0.040000
msm0.040000
toronto0.039604
mild0.039604
LOWER IN severe0.039604
commonwealth of pennsylvania0.039604
thailand0.039604
age 8-120.039604
lima0.039604
shantytown0.039604
age 30-500.039604
oslo0.039604
age 30-400.039604
age 13-140.039604
age 130.039604
papio kindae0.039604
papio ursinus0.039604
LOWER IN small village0.039604
hadza0.039604
LOWER IN age < 1 year0.039604
LOWER IN mouth mucosa0.039604
LOWER IN infant0.039216
LOWER IN rural community0.039216
tanzania0.038835
state of michigan0.038462
high bmi0.038095
juvenile organism0.038095
hunter gatherer0.038095
duodenum0.038095
belgium0.036697
LOWER IN mouth0.036036
australia0.035714
skin0.033058
daycare0.020202
age 1-5 years0.020202
trichuriasis0.020202
LOWER IN high arabinoxylan and resistant starch diet0.020202
LOWER IN arabinoxylan diet0.020202
centererians0.020202
salmonella gastroenteritis0.020202
native american0.020202
arapaho0.020202
cheyenne0.020202
age 17-290.020202
denver0.020202
age 200.020202
metabolic syndrome x0.020202
hmong0.020202
azerbaijan0.020202
LOWER IN inflammatory bowel disease0.020202
irritable bowel syndrome0.020202
LOWER IN irritable bowel syndrome0.020202
myanmar0.020202
karen0.020202
cron diet0.020202
LOWER IN india0.020202
LOWER IN plant diet0.020202
glasgow0.020202
baboon0.020202
papio0.020202
LOWER IN papio anubis0.020202
estonia0.020202
LOWER IN peru0.020202
LOWER IN tunapuco0.020202
LOWER IN age 3-60.020202
Fraction of dbbact annotations with this term covered by the query
TermScore
metabolic syndrome0.666667
state of oklahoma0.666667
homosexual0.666667
gay0.666667
msm0.666667
biopsy0.600000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
LOWER IN high arabinoxylan and resistant starch diet0.500000
LOWER IN arabinoxylan diet0.500000
toronto0.500000
biopsy site0.500000
mild0.500000
LOWER IN severe0.500000
centererians0.500000
salmonella gastroenteritis0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
denver0.500000
age 200.500000
metabolic syndrome x0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
age 30-500.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
LOWER IN plant diet0.500000
glasgow0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio kindae0.500000
papio ursinus0.500000
LOWER IN papio anubis0.500000
estonia0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
LOWER IN age 3-60.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondylitis0.500000
spondyloarthritis0.500000
kinda baboon0.500000
atherosclerosis0.500000
grayfoot chacma baboon0.500000
LOWER IN el salado0.500000
india0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
new delhi0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.927835
feces0.886598
adult0.412371
united states of america0.350515
control0.134021
child0.113402
china0.113402
city0.103093
female0.051546
obsolete_juvenile stage0.051546
infant0.051546
biopsy0.041237
LOWER IN crohn's disease0.041237
age0.041237
rural community0.041237
kingdom of denmark0.030928
metabolic syndrome0.030928
biopsy site0.030928
rectum0.030928
LOWER IN ulcerative colitis0.030928
state of oklahoma0.030928
united kingdom0.030928
state of colorado0.030928
jiangsu province0.030928
kingdom of spain0.030928
kingdom of norway0.030928
finland0.030928
zambia0.030928
monkey0.030928
wild0.030928
india0.030928
chuquisaca department0.030928
bolivia0.030928
age 5-13 years0.030928
LOWER IN control0.020619
toronto0.020619
mild0.020619
LOWER IN severe0.020619
australia0.020619
commonwealth of pennsylvania0.020619
state of michigan0.020619
high bmi0.020619
homosexual0.020619
gay0.020619
msm0.020619
thailand0.020619
age 8-120.020619
belgium0.020619
lima0.020619
shantytown0.020619
age 30-500.020619
oslo0.020619
age 30-400.020619
age 13-140.020619
age 130.020619
juvenile organism0.020619
LOWER IN infant0.020619
papio kindae0.020619
papio ursinus0.020619
LOWER IN small village0.020619
LOWER IN rural community0.020619
tanzania0.020619
hadza0.020619
hunter gatherer0.020619
LOWER IN age < 1 year0.020619
duodenum0.020619
LOWER IN mouth mucosa0.020619
LOWER IN mouth0.020619
skin0.020619
colombia0.010309
medellin metropolitan area0.010309
daycare0.010309
age 1-5 years0.010309
trichuriasis0.010309
control diet0.010309
LOWER IN high arabinoxylan and resistant starch diet0.010309
LOWER IN plant fiber cell0.010309
LOWER IN high fiber0.010309
LOWER IN arabinoxylan diet0.010309
male0.010309
LOWER IN female0.010309
sichuan province0.010309
centererians0.010309
LOWER IN adult0.010309
diarrhea0.010309
hospital0.010309
salmonella gastroenteritis0.010309
commonwealth of virginia0.010309
systemic lupus erythematosus0.010309
native american0.010309
arapaho0.010309
cheyenne0.010309
age 17-290.010309
body mass index0.010309
LOWER IN low bmi0.010309
msw0.010309
heterosexual0.010309
italy0.010309
obesity0.010309
denver0.010309
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 9
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org