Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCCTGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.555443
feces0.445127
adult0.391054
united states of america0.199279
child0.169978
city0.158311
china0.105033
control0.100309
obsolete_juvenile stage0.087209
infant0.082988
biopsy0.076433
LOWER IN crohn's disease0.074766
rural community0.071429
age0.068376
female0.065359
metabolic syndrome0.058537
state of oklahoma0.058537
biopsy site0.057692
zambia0.057692
india0.057692
chuquisaca department0.057692
kingdom of denmark0.056075
rectum0.056075
age 5-13 years0.056075
LOWER IN ulcerative colitis0.055300
state of colorado0.055300
finland0.055300
jiangsu province0.054545
kingdom of norway0.054545
bolivia0.054545
united kingdom0.053812
monkey0.049180
kingdom of spain0.046875
wild0.044776
gay0.039604
toronto0.039216
mild0.039216
LOWER IN severe0.039216
commonwealth of pennsylvania0.039216
homosexual0.039216
msm0.039216
thailand0.039216
age 8-120.039216
lima0.039216
shantytown0.039216
age 30-500.039216
oslo0.039216
age 30-400.039216
age 13-140.039216
age 130.039216
papio kindae0.039216
papio ursinus0.039216
LOWER IN small village0.039216
hadza0.039216
LOWER IN age < 1 year0.039216
LOWER IN mouth mucosa0.039216
LOWER IN infant0.038835
LOWER IN rural community0.038835
tanzania0.038462
state of michigan0.038095
high bmi0.037736
juvenile organism0.037736
hunter gatherer0.037736
duodenum0.037383
belgium0.035714
LOWER IN mouth0.035714
australia0.035398
skin0.032520
daycare0.020000
age 1-5 years0.020000
trichuriasis0.020000
LOWER IN high arabinoxylan and resistant starch diet0.020000
LOWER IN arabinoxylan diet0.020000
male0.020000
centererians0.020000
salmonella gastroenteritis0.020000
native american0.020000
arapaho0.020000
cheyenne0.020000
age 17-290.020000
denver0.020000
age 200.020000
metabolic syndrome x0.020000
hmong0.020000
azerbaijan0.020000
LOWER IN inflammatory bowel disease0.020000
irritable bowel syndrome0.020000
LOWER IN irritable bowel syndrome0.020000
myanmar0.020000
karen0.020000
cron diet0.020000
LOWER IN india0.020000
LOWER IN plant diet0.020000
glasgow0.020000
baboon0.020000
papio0.020000
LOWER IN papio anubis0.020000
estonia0.020000
LOWER IN peru0.020000
LOWER IN tunapuco0.020000
Fraction of dbbact annotations with this term covered by the query
TermScore
metabolic syndrome0.666667
state of oklahoma0.666667
gay0.666667
biopsy0.600000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
LOWER IN high arabinoxylan and resistant starch diet0.500000
LOWER IN arabinoxylan diet0.500000
toronto0.500000
male0.500000
biopsy site0.500000
mild0.500000
LOWER IN severe0.500000
centererians0.500000
salmonella gastroenteritis0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
denver0.500000
homosexual0.500000
msm0.500000
age 200.500000
metabolic syndrome x0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
age 30-500.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
LOWER IN plant diet0.500000
glasgow0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio kindae0.500000
papio ursinus0.500000
LOWER IN papio anubis0.500000
estonia0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
LOWER IN age 3-60.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
kinda baboon0.500000
canada0.500000
atherosclerosis0.500000
grayfoot chacma baboon0.500000
LOWER IN el salado0.500000
age 1-20.500000
LOWER IN age 0-10.500000
india0.500000
bangladesh0.500000
tunapuco0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
new delhi0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.928571
feces0.887755
adult0.418367
united states of america0.346939
control0.132653
china0.122449
child0.112245
city0.102041
female0.051020
obsolete_juvenile stage0.051020
infant0.051020
biopsy0.040816
LOWER IN crohn's disease0.040816
age0.040816
rural community0.040816
kingdom of denmark0.030612
metabolic syndrome0.030612
biopsy site0.030612
rectum0.030612
LOWER IN ulcerative colitis0.030612
state of oklahoma0.030612
united kingdom0.030612
state of colorado0.030612
jiangsu province0.030612
kingdom of spain0.030612
kingdom of norway0.030612
finland0.030612
zambia0.030612
monkey0.030612
wild0.030612
india0.030612
age 5-13 years0.030612
bolivia0.030612
chuquisaca department0.030612
LOWER IN control0.020408
toronto0.020408
mild0.020408
LOWER IN severe0.020408
australia0.020408
commonwealth of pennsylvania0.020408
state of michigan0.020408
high bmi0.020408
homosexual0.020408
gay0.020408
msm0.020408
thailand0.020408
age 8-120.020408
belgium0.020408
lima0.020408
shantytown0.020408
age 30-500.020408
oslo0.020408
age 30-400.020408
age 13-140.020408
age 130.020408
juvenile organism0.020408
LOWER IN infant0.020408
papio kindae0.020408
papio ursinus0.020408
LOWER IN small village0.020408
LOWER IN rural community0.020408
tanzania0.020408
hadza0.020408
hunter gatherer0.020408
LOWER IN age < 1 year0.020408
duodenum0.020408
LOWER IN mouth mucosa0.020408
LOWER IN mouth0.020408
skin0.020408
colombia0.010204
medellin metropolitan area0.010204
daycare0.010204
age 1-5 years0.010204
trichuriasis0.010204
control diet0.010204
LOWER IN high arabinoxylan and resistant starch diet0.010204
LOWER IN plant fiber cell0.010204
LOWER IN high fiber0.010204
LOWER IN arabinoxylan diet0.010204
male0.010204
LOWER IN female0.010204
sichuan province0.010204
centererians0.010204
LOWER IN adult0.010204
hospital0.010204
salmonella gastroenteritis0.010204
diarrhea0.010204
commonwealth of virginia0.010204
systemic lupus erythematosus0.010204
native american0.010204
arapaho0.010204
cheyenne0.010204
age 17-290.010204
body mass index0.010204
LOWER IN low bmi0.010204
msw0.010204
heterosexual0.010204
italy0.010204
obesity0.010204
denver0.010204
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 9
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org