Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCATAGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.593785
feces0.509795
adult0.402990
child0.266010
united states of america0.222650
control0.152704
rural community0.135942
obsolete_juvenile stage0.124646
china0.107314
city0.103152
LOWER IN crohn's disease0.088608
jiangsu province0.088398
pig0.082353
sus scrofa0.082353
infant0.080367
india0.075949
age 5-13 years0.063898
age0.059524
hunter gatherer0.051836
chuquisaca department0.050955
zoological garden0.050104
state of colorado0.049080
female0.049020
bolivia0.048485
united kingdom0.047904
italy0.047337
farm0.041026
LOWER IN age < 1 year0.039216
small village0.039216
state of oklahoma0.039088
nigeria0.039088
age 2-4 years0.038710
age 8-120.038710
taiwan0.038710
taipei city0.038710
age 3-60.038710
age 50-60 years0.038710
nanning city prefecture0.038710
left colon0.038710
age 130.038710
LOWER IN ulcerative colitis0.038462
state of michigan0.038462
biopsy0.038339
right colon0.038339
thailand0.037975
jiangxi province0.037975
finland0.037618
juvenile organism0.037267
monkey0.037267
duodenum0.036923
kingdom of spain0.036585
skin0.034483
state of california0.033803
caecum0.032967
canada0.026490
age > 1 year0.026316
heterosexual0.026316
msw0.026316
gay0.026316
amerindian0.026316
venezuela0.026316
papio anubis0.026316
olive baboon0.026316
age<17 years0.026144
bangladesh0.026144
commonwealth of pennsylvania0.026144
denver0.026144
homosexual0.026144
msm0.026144
himalayas0.026144
nanchang city prefecture0.026144
age 60-790.026144
age 30-500.026144
new delhi0.026144
age >940.026144
glasgow0.026144
oslo0.026144
age 30-400.026144
kebbi state0.026144
age 10-15 years0.026144
hadza0.026144
weaned0.026144
age 4-7 weeks0.026144
corn and soybean diet0.026144
africa0.026144
LOWER IN mouth mucosa0.026144
LOWER IN infant0.025974
atlanta0.025806
nepal0.025806
LOWER IN child0.025806
age < 3 years0.025806
tanzania0.025806
kingdom of denmark0.025806
ulcerative colitis0.025641
high bmi0.025478
biopsy site0.025478
small intestine0.025478
LOWER IN finland0.025478
LOWER IN duodenum0.025478
rectum0.025316
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
rural community0.857143
LOWER IN crohn's disease0.777778
LOWER IN age < 1 year0.750000
hunter gatherer0.750000
small village0.750000
state of oklahoma0.666667
age > 1 year0.666667
nigeria0.666667
india0.666667
age 5-13 years0.666667
heterosexual0.666667
msw0.666667
gay0.666667
amerindian0.666667
venezuela0.666667
papio anubis0.666667
olive baboon0.666667
LOWER IN native american0.500000
american0.500000
LOWER IN arapaho0.500000
LOWER IN cheyenne0.500000
age 2-4 years0.500000
child0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
age 8-120.500000
taiwan0.500000
taipei city0.500000
age 3-60.500000
age<17 years0.500000
remission0.500000
sudan0.500000
bangladesh0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
LOWER IN insomnia0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
quito0.500000
denver0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
homosexual0.500000
msm0.500000
age 200.500000
himalayas0.500000
raji0.500000
nanchang city prefecture0.500000
hmong0.500000
azerbaijan0.500000
chepang0.500000
age 19-240.500000
LOWER IN inflammatory bowel disease0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
chuquisaca department0.500000
age 30-500.500000
left colon0.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
glasgow0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
LOWER IN india0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
el salvador0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
estonia0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
low anterior resection0.500000
age 1-3 years0.500000
spondyloarthritis0.500000
spondylitis0.500000
zambia0.500000
papio kindae0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.906040
homo sapiens0.885906
adult0.389262
united states of america0.315436
child0.181208
control0.161074
china0.161074
obsolete_juvenile stage0.073826
rural community0.073826
city0.060403
jiangsu province0.053691
infant0.046980
LOWER IN crohn's disease0.046980
pig0.046980
sus scrofa0.046980
india0.040268
age0.033557
age 5-13 years0.033557
female0.033557
italy0.026846
state of colorado0.026846
bolivia0.026846
chuquisaca department0.026846
hunter gatherer0.026846
united kingdom0.026846
farm0.026846
zoological garden0.026846
state of oklahoma0.020134
age 2-4 years0.020134
age 8-120.020134
taiwan0.020134
taipei city0.020134
age 3-60.020134
LOWER IN age < 1 year0.020134
LOWER IN ulcerative colitis0.020134
state of california0.020134
nigeria0.020134
state of michigan0.020134
age 50-60 years0.020134
nanning city prefecture0.020134
thailand0.020134
biopsy0.020134
right colon0.020134
left colon0.020134
kingdom of spain0.020134
duodenum0.020134
age 130.020134
juvenile organism0.020134
finland0.020134
small village0.020134
jiangxi province0.020134
monkey0.020134
skin0.020134
caecum0.020134
czech republic0.013423
australia0.013423
age > 1 year0.013423
age<17 years0.013423
atlanta0.013423
bangladesh0.013423
ulcerative colitis0.013423
commonwealth of pennsylvania0.013423
denver0.013423
heterosexual0.013423
msw0.013423
high bmi0.013423
homosexual0.013423
gay0.013423
msm0.013423
himalayas0.013423
nepal0.013423
nanchang city prefecture0.013423
biopsy site0.013423
LOWER IN child0.013423
belgium0.013423
age 60-790.013423
age 30-500.013423
new delhi0.013423
small intestine0.013423
amerindian0.013423
venezuela0.013423
age >940.013423
glasgow0.013423
canis lupus familiaris0.013423
dog0.013423
kingdom of norway0.013423
oslo0.013423
age 30-400.013423
LOWER IN infant0.013423
kebbi state0.013423
age 10-15 years0.013423
age < 3 years0.013423
LOWER IN finland0.013423
tanzania0.013423
hadza0.013423
canada0.013423
rectum0.013423
weaned0.013423
age 4-7 weeks0.013423
corn and soybean diet0.013423
Exp. ID User ID Description Date Region Flag Sequences
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
564amnonhighfreq control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 18
552amnonhighfreq feces, homo sapiens, czech republic2019-09-05v3No1 / 22
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
529amnonhighfreq homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org