Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.620118
feces0.570283
adult0.391532
child0.248963
united states of america0.248766
control0.161694
obsolete_juvenile stage0.144796
china0.123985
city0.122312
rural community0.092975
jiangsu province0.090498
LOWER IN crohn's disease0.073684
india0.073107
infant0.067895
pig0.061697
sus scrofa0.061697
zoological garden0.060914
age0.060000
age 5-13 years0.053050
hunter gatherer0.042934
state of oklahoma0.042781
LOWER IN ulcerative colitis0.042553
female0.042373
age 8-120.042328
chuquisaca department0.042328
czech republic0.041451
state of colorado0.041026
bolivia0.040609
united kingdom0.040201
farm0.037795
canada0.032609
LOWER IN age < 1 year0.032432
small village0.032432
nigeria0.032345
thailand0.032345
papio anubis0.032345
colombia0.032258
LOWER IN rural community0.032258
sudan0.032086
glasgow0.032086
lima0.032086
shantytown0.032086
age 30-500.032086
age 13-140.032086
age 3-60.032086
new delhi0.032086
age 50-60 years0.032086
nanning city prefecture0.032086
obesity0.032086
age 130.032086
state of michigan0.031915
biopsy0.031830
high bmi0.031746
american diet0.031579
finland0.031332
kingdom of norway0.031088
juvenile organism0.031088
duodenum0.030848
commonwealth of virginia0.030612
state of california0.028640
dog0.028037
skin0.027460
canis lupus familiaris0.026549
research facility0.025779
mus musculus0.022642
age > 1 year0.021739
heterosexual0.021739
msw0.021739
gay0.021739
metabolic syndrome0.021739
amerindian0.021739
venezuela0.021739
olive baboon0.021739
native american0.021622
arapaho0.021622
cheyenne0.021622
jordan0.021622
age<17 years0.021622
LOWER IN diarrhea0.021622
bangladesh0.021622
commonwealth of pennsylvania0.021622
denver0.021622
LOWER IN exocrine pancreatic insufficiency0.021622
homosexual0.021622
msm0.021622
nanchang city prefecture0.021622
age 60-790.021622
left colon0.021622
age >940.021622
oslo0.021622
age 30-400.021622
kebbi state0.021622
age 10-15 years0.021622
LOWER IN small village0.021622
hadza0.021622
weaned0.021622
age 4-7 weeks0.021622
corn and soybean diet0.021622
africa0.021622
wastewater treatment plant0.021622
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
LOWER IN crohn's disease0.777778
LOWER IN age < 1 year0.750000
hunter gatherer0.750000
small village0.750000
rural community0.714286
state of oklahoma0.666667
age > 1 year0.666667
india0.666667
nigeria0.666667
heterosexual0.666667
msw0.666667
age 5-13 years0.666667
gay0.666667
metabolic syndrome0.666667
thailand0.666667
amerindian0.666667
venezuela0.666667
papio anubis0.666667
olive baboon0.666667
colombia0.600000
LOWER IN rural community0.600000
LOWER IN ulcerative colitis0.571429
child0.500000
sudan0.500000
LOWER IN type i diabetes mellitus0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
glasgow0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
lima0.500000
shantytown0.500000
age 30-500.500000
age 8-120.500000
jordan0.500000
age 13-140.500000
age 3-60.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
age<17 years0.500000
remission0.500000
age 30-50 years0.500000
LOWER IN age 50-80 years0.500000
new delhi0.500000
LOWER IN diarrhea0.500000
bangladesh0.500000
age 2-4 years0.500000
LOWER IN cron diet0.500000
schizophrenia0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
denver0.500000
quito0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
obesity0.500000
homosexual0.500000
msm0.500000
age 200.500000
LOWER IN egypt0.500000
himalayas0.500000
raji0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
hmong0.500000
azerbaijan0.500000
age 19-240.500000
LOWER IN inflammatory bowel disease0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
chuquisaca department0.500000
left colon0.500000
irritable bowel syndrome0.500000
age >940.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 130.500000
obese body mass index status0.500000
db/db mouse0.500000
toronto0.500000
LOWER IN india0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
el salvador0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
LOWER IN age 1-3 weeks0.500000
LOWER IN age 3-60.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.917127
homo sapiens0.861878
adult0.359116
united states of america0.348066
child0.165746
control0.154696
china0.154696
obsolete_juvenile stage0.088398
city0.071823
jiangsu province0.055249
rural community0.049724
infant0.038674
LOWER IN crohn's disease0.038674
india0.038674
age0.033149
pig0.033149
sus scrofa0.033149
zoological garden0.033149
age 5-13 years0.027624
female0.027624
state of oklahoma0.022099
czech republic0.022099
age 8-120.022099
LOWER IN ulcerative colitis0.022099
united kingdom0.022099
state of colorado0.022099
bolivia0.022099
chuquisaca department0.022099
research facility0.022099
hunter gatherer0.022099
farm0.022099
sudan0.016575
commonwealth of virginia0.016575
american diet0.016575
glasgow0.016575
lima0.016575
shantytown0.016575
age 30-500.016575
age 13-140.016575
age 3-60.016575
LOWER IN age < 1 year0.016575
new delhi0.016575
state of california0.016575
nigeria0.016575
state of michigan0.016575
high bmi0.016575
colombia0.016575
age 50-60 years0.016575
nanning city prefecture0.016575
canis lupus familiaris0.016575
dog0.016575
obesity0.016575
thailand0.016575
biopsy0.016575
mus musculus0.016575
duodenum0.016575
kingdom of norway0.016575
age 130.016575
juvenile organism0.016575
finland0.016575
small village0.016575
LOWER IN rural community0.016575
canada0.016575
papio anubis0.016575
skin0.016575
systemic lupus erythematosus0.011050
native american0.011050
arapaho0.011050
cheyenne0.011050
germany0.011050
jordan0.011050
age > 1 year0.011050
age<17 years0.011050
atlanta0.011050
south korea0.011050
russia0.011050
age < 3 years0.011050
LOWER IN diarrhea0.011050
bangladesh0.011050
italy0.011050
ulcerative colitis0.011050
commonwealth of pennsylvania0.011050
body mass index0.011050
LOWER IN low bmi0.011050
denver0.011050
heterosexual0.011050
msw0.011050
LOWER IN exocrine pancreatic insufficiency0.011050
homosexual0.011050
gay0.011050
msm0.011050
metabolic syndrome0.011050
nanchang city prefecture0.011050
biopsy site0.011050
right colon0.011050
LOWER IN child0.011050
belgium0.011050
age 60-790.011050
left colon0.011050
mouse0.011050
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
242amnonhigh freq. in native-americans (highfreq homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
552amnonhighfreq feces, homo sapiens, czech republic2019-09-05v3No1 / 22
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
303amnonhighfreq homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
438amnonhighfreq feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 26
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-16v4No1 / 39
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
568amnoncommon viet nam, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 272
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
568amnoncommon thailand, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 320
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org