Search result for sequence:
TACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAATAAGTCGAATGTTAAAGATCGGGGCTCAACCCCGTAAAGCATTGGAAACTGATAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.279070
skin0.193939
united states of america0.178641
poland0.161725
adult0.133588
vagina0.133333
belgium0.117936
pair of nares0.102752
male0.101449
beetle0.101449
feces0.094845
female0.089888
whole body0.088050
child0.079208
phoenix0.078740
nasal cavity0.077973
air0.076482
south africa0.074349
state of arizona0.072993
city0.071685
australia0.071429
diabetes mellitus0.065041
arm0.065041
state of florida0.064725
rectal swab0.064000
herbivorous beetle0.064000
centrocercus urophasianus0.064000
greater sage-grouse0.064000
state of wyoming0.064000
foot0.062016
sweden0.061381
LOWER IN caecum0.060759
atlantic ocean0.060150
msm0.058394
homosexual0.058394
infant0.056206
bird0.053691
building0.049383
yellowstone national park0.048780
nida basin0.048780
north america0.048780
respiratory airway0.048780
exhaled air condensate0.048780
whale blow0.048780
urban biome0.048780
south florida0.048780
shark0.048780
chuquisaca department0.048780
forearm0.048780
carnivorous beetle0.048780
hefei city prefecture0.048780
baijiu0.048780
geothermal field0.047619
megaptera novaeangliae0.047619
humpback whale0.047619
age 5-13 years0.047619
mud0.047619
fermentation pit mud0.047619
nasopharynx0.047244
biopsy site0.046512
high temperature environment0.046512
hiv infection0.046512
bolivia0.046512
duodenum0.045977
pig0.045977
sus scrofa0.045977
biopsy0.044444
colon0.044118
plant0.042553
rural community0.041667
research facility0.039880
river0.039216
LOWER IN control0.034542
LOWER IN nasopharynx0.033333
venezuela0.033333
amerindian0.033333
invasive carcinoma0.033058
invasive cervical carcinoma0.033058
cervical carcinoma0.033058
wound0.033058
ulcer0.033058
penis0.033058
male organism0.033058
lapland0.033058
anterior naris0.033058
bathroom0.033058
shower0.033058
tile0.033058
building wall0.033058
raba river0.033058
hong kong0.033058
hunter gatherer0.033058
decaying0.033058
days 180-2700.033058
sea urchin0.033058
LOWER IN right colon0.032787
state of tennessee0.032787
paranasal sinus0.032520
sinusoidal space0.032520
hot spring0.032520
Fraction of dbbact annotations with this term covered by the query
TermScore
poland1.500000
diabetes mellitus0.666667
building0.666667
LOWER IN nasopharynx0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
sudan0.500000
vagina0.500000
phoenix0.500000
invasive carcinoma0.500000
invasive cervical carcinoma0.500000
cervical carcinoma0.500000
dysplasia of cervix0.500000
maxillary sinus0.500000
ethmoid sinus0.500000
wound0.500000
ulcer0.500000
yellowstone national park0.500000
LOWER IN dysplasia of cervix0.500000
penis0.500000
male organism0.500000
rectal swab0.500000
skin of body0.500000
umbilicus0.500000
lapland0.500000
LOWER IN state of colorado0.500000
anterior naris0.500000
nasal brush0.500000
ursus arctos0.500000
brown bear0.500000
sebum0.500000
nasal cavity mucosa0.500000
LOWER IN luminal content0.500000
aphthona venustula0.500000
nida basin0.500000
herbivorous beetle0.500000
nicotiana galuca0.500000
bedroom0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
bumble bee0.500000
queen0.500000
hibernation0.500000
LOWER IN non hibernating0.500000
age <1 year0.500000
centricnemus leucogrammus0.500000
age <=24 hours0.500000
LOWER IN age >= 7 days0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN pacific ocean0.500000
bathroom0.500000
shower0.500000
tile0.500000
urban biome0.500000
building wall0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
LOWER IN skin under eye0.500000
LOWER IN bacterial vaginosis0.500000
south florida0.500000
shark0.500000
thermophilic sediment0.500000
train0.500000
boston0.500000
olsztyn0.500000
gut0.500000
esox lucius0.500000
pike fry0.500000
chuquisaca department0.500000
forearm0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion modestum0.500000
LOWER IN estonia0.500000
hong kong0.500000
age one month0.500000
LOWER IN age one year0.500000
coturnix coturnix0.500000
common quail0.500000
crioceris duodecimpunctata0.500000
subway0.500000
anal canal0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
glasgow0.500000
hunter gatherer0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
bembidion decorum0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.564103
united states of america0.393162
feces0.196581
adult0.179487
skin0.136752
poland0.085470
vagina0.076923
female0.076923
belgium0.068376
male0.059829
pair of nares0.059829
whole body0.059829
beetle0.059829
child0.051282
australia0.051282
LOWER IN control0.042735
phoenix0.042735
state of arizona0.042735
control0.042735
south africa0.042735
nasal cavity0.042735
air0.042735
research facility0.042735
state of florida0.042735
city0.042735
china0.042735
diabetes mellitus0.034188
foot0.034188
rectal swab0.034188
msm0.034188
homosexual0.034188
sweden0.034188
herbivorous beetle0.034188
bird0.034188
centrocercus urophasianus0.034188
greater sage-grouse0.034188
state of wyoming0.034188
LOWER IN caecum0.034188
infant0.034188
atlantic ocean0.034188
arm0.034188
nasopharynx0.025641
colon0.025641
biopsy0.025641
biopsy site0.025641
yellowstone national park0.025641
geothermal field0.025641
high temperature environment0.025641
hiv infection0.025641
plant0.025641
nida basin0.025641
building0.025641
duodenum0.025641
north america0.025641
megaptera novaeangliae0.025641
humpback whale0.025641
respiratory airway0.025641
exhaled air condensate0.025641
whale blow0.025641
urban biome0.025641
south florida0.025641
shark0.025641
age 5-13 years0.025641
bolivia0.025641
rural community0.025641
chuquisaca department0.025641
forearm0.025641
carnivorous beetle0.025641
river0.025641
mud0.025641
hefei city prefecture0.025641
baijiu0.025641
fermentation pit mud0.025641
pig0.025641
sus scrofa0.025641
obsolete_juvenile stage0.017094
invasive carcinoma0.017094
invasive cervical carcinoma0.017094
cervical carcinoma0.017094
paranasal sinus0.017094
sinusoidal space0.017094
sinusitis0.017094
wound0.017094
ulcer0.017094
left colon0.017094
LOWER IN right colon0.017094
water0.017094
hot spring0.017094
rectum0.017094
penis0.017094
male organism0.017094
snow0.017094
depth 0-5cm0.017094
lapland0.017094
kingdom of norway0.017094
finland0.017094
anterior naris0.017094
crohn's disease0.017094
new york city0.017094
conjunctiva0.017094
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 5
535amnoncommon in healthy adult vaginal samples (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 7
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 11
567amnoncommon belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 11
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
63amnonhigh freq. in skin in american gut (dominant skin, homo sapiens)2017-02-15v4No1 / 13
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 14
409amnon high in left colon compared to right colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v4No1 / 15
198amnondominant yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 16
213amnondominant homo sapiens, south africa, vagina2017-10-22v4No1 / 16
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 16
606amnondominant penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 17
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 18
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 20
511amnon high in lapland kingdom of norway finland sweden compared to united states of america state of colorado in snow depth 0-5cm 2019-03-20v4No1 / 21
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 31
399amnon high in ulcerative colitis compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 36
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon air, building, bedroom, united states of america, chicago, state of illinois2019-07-03v4No1 / 58
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
596amnon high in age <1 year compared to age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
323amnoncommon in shark cloaca (common atlantic ocean, south florida, state of florida, united states of america, shark, anal canal)2018-04-24v4No1 / 167
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud hefei city prefecture china baijiu fermentation pit mud )2020-04-05v3No1 / 205
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, san francisco bay2018-03-12v4No1 / 558
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130

Problems / suggestions? Please email info AT dbbact DOT org