Search result for sequence:
TACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGCAAGTCAGAAGTGAAAGCCTGGGGCTCAACCCCGGAATTGCTTTTGAAACTGTCAGGCTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.589231
feces0.484237
adult0.439197
united states of america0.211852
child0.173913
control0.146580
city0.126316
obsolete_juvenile stage0.109948
LOWER IN crohn's disease0.106195
jiangsu province0.093750
infant0.091603
india0.089686
china0.085837
rural community0.067797
age0.065041
LOWER IN rural community0.055046
age 60-790.054545
age 30-500.054545
chuquisaca department0.054545
age 5-13 years0.054545
LOWER IN ulcerative colitis0.054054
biopsy0.053812
duodenum0.051724
kingdom of norway0.051724
bolivia0.051724
kingdom of spain0.050420
state of california0.045283
female0.044118
heterosexual0.037383
msw0.037383
LOWER IN gay0.037383
LOWER IN msm0.037383
LOWER IN homosexual0.037383
age<17 years0.037037
nanchang city prefecture0.037037
new delhi0.037037
glasgow0.037037
oslo0.037037
age 30-400.037037
age 130.037037
small village0.037037
LOWER IN age < 1 year0.037037
age 50-60 years0.037037
nanning city prefecture0.037037
LOWER IN mouth mucosa0.037037
LOWER IN hiv infection0.036697
LOWER IN infant0.036697
atlanta0.036364
state of oklahoma0.036364
LOWER IN child0.036364
age < 3 years0.036364
kingdom of denmark0.036364
state of michigan0.036036
state of colorado0.036036
finland0.036036
high bmi0.035714
biopsy site0.035714
small intestine0.035714
juvenile organism0.035714
LOWER IN finland0.035714
ethiopia0.035714
united kingdom0.035398
rectum0.035398
czech republic0.035088
belgium0.034483
LOWER IN mouth0.033898
monkey0.033333
non c. diff diarrhea0.018868
LOWER IN clostridium difficile intestinal infectious disease0.018868
schizophrenia0.018868
age 17-290.018868
age 200.018868
LOWER IN egypt0.018868
age 19-240.018868
denver0.018868
age 8-120.018868
age 3-60.018868
mild0.018868
LOWER IN severe0.018868
gangcha region0.018868
LOWER IN gannan tibetan autonomous prefecture0.018868
irritable bowel syndrome0.018868
age >940.018868
cron diet0.018868
age 13-140.018868
toronto0.018868
el salvador0.018868
estonia0.018868
LOWER IN peru0.018868
LOWER IN tunapuco0.018868
low anterior resection0.018868
taipei city0.018868
taiwan0.018868
age 1-3 years0.018868
low income0.018868
LOWER IN sewer0.018868
LOWER IN wastewater treatment plant0.018868
spondylitis0.018868
spondyloarthritis0.018868
LOWER IN age >940.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn's disease0.666667
heterosexual0.666667
msw0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
india0.666667
LOWER IN rural community0.600000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
age<17 years0.500000
schizophrenia0.500000
age 17-290.500000
age 200.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
age 19-240.500000
denver0.500000
age 8-120.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
el salvador0.500000
small village0.500000
estonia0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
low anterior resection0.500000
taipei city0.500000
taiwan0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondylitis0.500000
spondyloarthritis0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
hadza0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN thailand0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
sigmoid colon0.500000
children0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
LOWER IN equus przewalskii0.500000
LOWER IN ulcerative colitis0.428571
homo sapiens0.426667
adult0.418919
LOWER IN hiv infection0.400000
biopsy0.400000
LOWER IN infant0.400000
child0.352941
city0.352941
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.951923
feces0.923077
adult0.461538
united states of america0.365385
control0.173077
china0.153846
child0.115385
city0.076923
obsolete_juvenile stage0.067308
LOWER IN crohn's disease0.057692
jiangsu province0.057692
infant0.057692
india0.048077
age0.038462
rural community0.038462
LOWER IN ulcerative colitis0.028846
state of california0.028846
female0.028846
biopsy0.028846
age 60-790.028846
age 30-500.028846
kingdom of spain0.028846
duodenum0.028846
kingdom of norway0.028846
LOWER IN rural community0.028846
chuquisaca department0.028846
bolivia0.028846
age 5-13 years0.028846
age<17 years0.019231
atlanta0.019231
LOWER IN hiv infection0.019231
state of michigan0.019231
high bmi0.019231
nanchang city prefecture0.019231
biopsy site0.019231
czech republic0.019231
state of colorado0.019231
heterosexual0.019231
msw0.019231
LOWER IN gay0.019231
LOWER IN msm0.019231
LOWER IN homosexual0.019231
belgium0.019231
state of oklahoma0.019231
new delhi0.019231
small intestine0.019231
glasgow0.019231
LOWER IN child0.019231
oslo0.019231
age 30-400.019231
age 130.019231
juvenile organism0.019231
finland0.019231
LOWER IN infant0.019231
small village0.019231
united kingdom0.019231
age < 3 years0.019231
LOWER IN finland0.019231
LOWER IN age < 1 year0.019231
rectum0.019231
age 50-60 years0.019231
nanning city prefecture0.019231
kingdom of denmark0.019231
monkey0.019231
ethiopia0.019231
LOWER IN mouth mucosa0.019231
LOWER IN mouth0.019231
australia0.009615
hospital0.009615
diarrhea0.009615
non c. diff diarrhea0.009615
LOWER IN clostridium difficile intestinal infectious disease0.009615
LOWER IN diarrhea0.009615
israel0.009615
ulcerative colitis0.009615
schizophrenia0.009615
age 17-290.009615
italy0.009615
obesity0.009615
state of arizona0.009615
age 200.009615
LOWER IN egypt0.009615
american diet0.009615
germany0.009615
right colon0.009615
age 19-240.009615
denver0.009615
age 8-120.009615
age 3-60.009615
mild0.009615
LOWER IN severe0.009615
tibetan plateau0.009615
tibet autonomous region0.009615
gangcha region0.009615
LOWER IN gannan tibetan autonomous prefecture0.009615
left colon0.009615
irritable bowel syndrome0.009615
age >940.009615
LOWER IN obsolete_juvenile stage0.009615
south korea0.009615
Exp. ID User ID Description Date Region Flag Sequences
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
532amnoncommon control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
18amnon high in equus caballus compared to equus przewalskii in feces 2016-11-14v4No1 / 1800

Problems / suggestions? Please email info AT dbbact DOT org