Search result for sequence:
TACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGCAAGTCAGAAGTGAAAGCCTGGGGCTCAACCCCGGAATTGCTTTTGAAACTGTCAGGCTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.570426
feces0.482831
adult0.431778
united states of america0.206647
child0.181637
control0.141287
city0.124352
obsolete_juvenile stage0.108247
LOWER IN crohn's disease0.104348
china0.096454
jiangsu province0.092308
infant0.090226
india0.088106
age 5-13 years0.071429
rural community0.066667
age0.064000
LOWER IN rural community0.054054
age 60-790.053571
age 30-500.053571
chuquisaca department0.053571
LOWER IN ulcerative colitis0.053097
biopsy0.052863
kingdom of norway0.050847
bolivia0.050847
duodenum0.050209
kingdom of spain0.049587
state of california0.044610
female0.043165
heterosexual0.036697
msw0.036697
LOWER IN gay0.036697
LOWER IN msm0.036697
LOWER IN homosexual0.036697
age<17 years0.036364
nanchang city prefecture0.036364
new delhi0.036364
glasgow0.036364
oslo0.036364
age 30-400.036364
age 130.036364
small village0.036364
LOWER IN age < 1 year0.036364
age 50-60 years0.036364
nanning city prefecture0.036364
LOWER IN mouth mucosa0.036364
LOWER IN infant0.036036
atlanta0.035714
LOWER IN hiv infection0.035714
state of oklahoma0.035714
LOWER IN child0.035714
age < 3 years0.035714
kingdom of denmark0.035714
state of michigan0.035398
state of colorado0.035398
finland0.035398
high bmi0.035088
biopsy site0.035088
small intestine0.035088
juvenile organism0.035088
LOWER IN finland0.035088
ethiopia0.035088
united kingdom0.034783
rectum0.034783
czech republic0.033898
belgium0.033333
LOWER IN mouth0.033333
monkey0.032787
non c. diff diarrhea0.018519
LOWER IN clostridium difficile intestinal infectious disease0.018519
schizophrenia0.018519
age 17-290.018519
quito0.018519
age 200.018519
LOWER IN egypt0.018519
age 19-240.018519
denver0.018519
age 8-120.018519
age 3-60.018519
mild0.018519
LOWER IN severe0.018519
gangcha region0.018519
LOWER IN gannan tibetan autonomous prefecture0.018519
irritable bowel syndrome0.018519
age >940.018519
cron diet0.018519
age 13-140.018519
toronto0.018519
el salvador0.018519
estonia0.018519
LOWER IN peru0.018519
LOWER IN tunapuco0.018519
taiwan0.018519
taipei city0.018519
low anterior resection0.018519
age 1-3 years0.018519
low income0.018519
LOWER IN sewer0.018519
LOWER IN wastewater treatment plant0.018519
spondyloarthritis0.018519
spondylitis0.018519
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn's disease0.666667
age 5-13 years0.666667
heterosexual0.666667
msw0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
india0.666667
LOWER IN rural community0.600000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
age<17 years0.500000
schizophrenia0.500000
age 17-290.500000
quito0.500000
age 200.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
age 19-240.500000
denver0.500000
age 8-120.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
age 130.500000
toronto0.500000
el salvador0.500000
small village0.500000
estonia0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
spondyloarthritis0.500000
spondylitis0.500000
LOWER IN age >940.500000
canada0.500000
atherosclerosis0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
male0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
hadza0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN thailand0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
sigmoid colon0.500000
children0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
bilbao0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
LOWER IN equus przewalskii0.500000
LOWER IN ulcerative colitis0.428571
homo sapiens0.408805
adult0.405063
biopsy0.400000
LOWER IN infant0.400000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.943396
feces0.924528
adult0.462264
united states of america0.358491
control0.169811
china0.160377
child0.122642
city0.075472
obsolete_juvenile stage0.066038
LOWER IN crohn's disease0.056604
jiangsu province0.056604
infant0.056604
india0.047170
age 5-13 years0.037736
age0.037736
rural community0.037736
LOWER IN ulcerative colitis0.028302
state of california0.028302
female0.028302
biopsy0.028302
age 60-790.028302
age 30-500.028302
kingdom of spain0.028302
duodenum0.028302
kingdom of norway0.028302
LOWER IN rural community0.028302
bolivia0.028302
chuquisaca department0.028302
age<17 years0.018868
atlanta0.018868
LOWER IN hiv infection0.018868
state of michigan0.018868
high bmi0.018868
nanchang city prefecture0.018868
biopsy site0.018868
czech republic0.018868
state of colorado0.018868
heterosexual0.018868
msw0.018868
LOWER IN gay0.018868
LOWER IN msm0.018868
LOWER IN homosexual0.018868
belgium0.018868
state of oklahoma0.018868
new delhi0.018868
small intestine0.018868
glasgow0.018868
LOWER IN child0.018868
oslo0.018868
age 30-400.018868
age 130.018868
juvenile organism0.018868
finland0.018868
LOWER IN infant0.018868
small village0.018868
united kingdom0.018868
age < 3 years0.018868
LOWER IN finland0.018868
LOWER IN age < 1 year0.018868
rectum0.018868
age 50-60 years0.018868
nanning city prefecture0.018868
kingdom of denmark0.018868
monkey0.018868
ethiopia0.018868
LOWER IN mouth mucosa0.018868
LOWER IN mouth0.018868
australia0.009434
hospital0.009434
non c. diff diarrhea0.009434
LOWER IN clostridium difficile intestinal infectious disease0.009434
diarrhea0.009434
israel0.009434
LOWER IN diarrhea0.009434
ulcerative colitis0.009434
schizophrenia0.009434
age 17-290.009434
ecuador0.009434
quito0.009434
italy0.009434
obesity0.009434
state of arizona0.009434
age 200.009434
LOWER IN egypt0.009434
american diet0.009434
germany0.009434
right colon0.009434
age 19-240.009434
denver0.009434
age 8-120.009434
age 3-60.009434
mild0.009434
LOWER IN severe0.009434
tibetan plateau0.009434
tibet autonomous region0.009434
gangcha region0.009434
LOWER IN gannan tibetan autonomous prefecture0.009434
left colon0.009434
irritable bowel syndrome0.009434
age >940.009434
Exp. ID User ID Description Date Region Flag Sequences
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
18amnon high in equus caballus compared to equus przewalskii in feces 2016-11-14v4No1 / 1800

Problems / suggestions? Please email info AT dbbact DOT org