Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.441497
feces0.352690
adult0.339846
child0.166667
control0.164384
united states of america0.164084
city0.152091
china0.126984
jiangsu province0.117647
LOWER IN ulcerative colitis0.117647
LOWER IN crohn's disease0.114943
canada0.113636
infant0.083333
age0.082474
colombia0.081633
skin0.078431
captive0.078431
zoological garden0.072727
india0.071429
czech republic0.068966
rural community0.067797
obsolete_juvenile stage0.064516
farm0.053333
age<17 years0.048780
commonwealth of pennsylvania0.048780
taiwan0.048780
taipei city0.048780
age 60-790.048780
age 30-500.048780
age >940.048780
cron diet0.048780
LOWER IN age < 1 year0.048780
age 50-60 years0.048780
nanning city prefecture0.048780
weaned0.048780
age 4-7 weeks0.048780
corn and soybean diet0.048780
african lion safari0.048780
toronto zoo0.048780
chuquisaca department0.048780
LOWER IN mouth mucosa0.048780
LOWER IN rural community0.048193
atlanta0.047619
low bmi0.047619
caloric restriction diet0.047619
jiangxi province0.047619
age 5-13 years0.047619
LOWER IN high bmi0.047059
bolivia0.046512
commonwealth of virginia0.045455
LOWER IN male0.044944
LOWER IN mouth0.043478
united kingdom0.041667
pig0.041667
sus scrofa0.041667
female0.036036
state of california0.034483
high hdl0.025000
LOWER IN low hdl0.025000
jordan0.025000
LOWER IN type i diabetes mellitus0.025000
age 2-4 years0.025000
age 8-120.025000
LOWER IN inflammatory bowel disease0.025000
age 3-60.025000
oslo0.025000
age 30-400.025000
age 13-140.025000
thailand0.025000
hmong0.025000
LOWER IN karen0.025000
LOWER IN myanmar0.025000
gallbladder0.025000
bile0.025000
cholelithiasis0.025000
LOWER IN peru0.025000
LOWER IN tunapuco0.025000
low anterior resection0.025000
age 1-3 years0.025000
low income0.025000
LOWER IN sewer0.025000
LOWER IN wastewater treatment plant0.025000
gastric carcinoma0.025000
stomach neoplasm0.025000
bogota0.025000
LOWER IN municipality of santiago de cali0.025000
LOWER IN bucaramanga0.025000
LOWER IN barranquilla0.025000
nephrolithiasis0.025000
age 1-20.025000
LOWER IN age 0-10.025000
bangladesh0.025000
nanchang city prefecture0.025000
LOWER IN pancreatitis0.025000
LOWER IN acute pancreatitis0.025000
LOWER IN nepal0.025000
LOWER IN himalayas0.025000
nanger granti0.025000
kenya0.025000
tropical grassland biome0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN ulcerative colitis0.714286
LOWER IN crohn's disease0.555556
high hdl0.500000
LOWER IN low hdl0.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
age<17 years0.500000
age 2-4 years0.500000
commonwealth of pennsylvania0.500000
taiwan0.500000
taipei city0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
age 60-790.500000
age 30-500.500000
age >940.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
india0.500000
bangladesh0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
male0.500000
african lion safari0.500000
canada0.500000
LOWER IN short bowel syndrome0.500000
sea urchin0.500000
artificial seawater0.500000
red kangaroo0.500000
macropus rufus0.500000
toronto zoo0.500000
camel0.500000
camelus dromedarius0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
children0.500000
new delhi0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
eland0.500000
tragelaphus oryx0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
chuquisaca department0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
LOWER IN rural community0.400000
LOWER IN diabetes mellitus0.333333
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
czech republic0.333333
lean body mass0.333333
low bmi0.333333
caloric restriction diet0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.871795
feces0.846154
adult0.435897
united states of america0.346154
control0.256410
china0.205128
child0.115385
city0.102564
jiangsu province0.076923
skin0.076923
LOWER IN crohn's disease0.064103
LOWER IN ulcerative colitis0.064103
canada0.064103
colombia0.051282
infant0.051282
age0.051282
captive0.051282
zoological garden0.051282
obsolete_juvenile stage0.038462
czech republic0.038462
rural community0.038462
india0.038462
farm0.038462
age<17 years0.025641
atlanta0.025641
commonwealth of virginia0.025641
state of california0.025641
commonwealth of pennsylvania0.025641
taiwan0.025641
taipei city0.025641
low bmi0.025641
LOWER IN high bmi0.025641
female0.025641
LOWER IN male0.025641
age 60-790.025641
age 30-500.025641
age >940.025641
cron diet0.025641
caloric restriction diet0.025641
united kingdom0.025641
LOWER IN rural community0.025641
LOWER IN age < 1 year0.025641
age 50-60 years0.025641
nanning city prefecture0.025641
pig0.025641
sus scrofa0.025641
jiangxi province0.025641
weaned0.025641
age 4-7 weeks0.025641
corn and soybean diet0.025641
african lion safari0.025641
toronto zoo0.025641
age 5-13 years0.025641
bolivia0.025641
chuquisaca department0.025641
LOWER IN mouth mucosa0.025641
LOWER IN mouth0.025641
high hdl0.012821
LOWER IN low hdl0.012821
jordan0.012821
LOWER IN type i diabetes mellitus0.012821
LOWER IN diabetes mellitus0.012821
LOWER IN systemic lupus erythematosus0.012821
italy0.012821
age 2-4 years0.012821
lean body mass0.012821
age 8-120.012821
LOWER IN child0.012821
LOWER IN inflammatory bowel disease0.012821
age 3-60.012821
south korea0.012821
kingdom of norway0.012821
oslo0.012821
age 30-400.012821
age 13-140.012821
thailand0.012821
hmong0.012821
LOWER IN karen0.012821
LOWER IN myanmar0.012821
gallbladder0.012821
bile0.012821
kingdom of spain0.012821
cholelithiasis0.012821
state of oklahoma0.012821
LOWER IN peru0.012821
LOWER IN small village0.012821
LOWER IN tunapuco0.012821
low anterior resection0.012821
age 1-3 years0.012821
state of texas0.012821
south america0.012821
low income0.012821
LOWER IN sewer0.012821
LOWER IN wastewater treatment plant0.012821
brazil0.012821
zhejiang province0.012821
stomach0.012821
gastric carcinoma0.012821
stomach neoplasm0.012821
LOWER IN control0.012821
Exp. ID User ID Description Date Region Flag Sequences
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
564amnoncommon control, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 50
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org