Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.447364
feces0.348548
adult0.341515
city0.166320
child0.166320
control0.165835
united states of america0.164201
china0.135021
LOWER IN ulcerative colitis0.131579
jiangsu province0.129032
LOWER IN crohn's disease0.128205
infant0.091954
age0.090909
colombia0.089888
india0.080000
rural community0.075472
obsolete_juvenile stage0.071429
age<17 years0.054795
commonwealth of pennsylvania0.054795
taipei city0.054795
taiwan0.054795
age 60-790.054795
age 30-500.054795
age >940.054795
cron diet0.054795
LOWER IN age < 1 year0.054795
age 50-60 years0.054795
nanning city prefecture0.054795
corn and soybean diet0.054795
age 4-7 weeks0.054795
weaned0.054795
LOWER IN mouth mucosa0.054795
chuquisaca department0.054795
age 5-13 years0.054795
LOWER IN rural community0.054054
atlanta0.053333
low bmi0.053333
caloric restriction diet0.053333
jiangxi province0.053333
LOWER IN high bmi0.052632
bolivia0.051948
commonwealth of virginia0.050633
czech republic0.050633
LOWER IN male0.050000
LOWER IN mouth0.048193
united kingdom0.045977
sus scrofa0.045977
pig0.045977
female0.039604
state of california0.037383
farm0.035398
high hdl0.028169
LOWER IN low hdl0.028169
jordan0.028169
LOWER IN type i diabetes mellitus0.028169
age 8-120.028169
LOWER IN inflammatory bowel disease0.028169
age 3-60.028169
oslo0.028169
age 30-400.028169
age 13-140.028169
thailand0.028169
hmong0.028169
LOWER IN karen0.028169
LOWER IN myanmar0.028169
cholelithiasis0.028169
bile0.028169
gallbladder0.028169
LOWER IN peru0.028169
LOWER IN tunapuco0.028169
low anterior resection0.028169
age 1-3 years0.028169
low income0.028169
LOWER IN sewer0.028169
LOWER IN wastewater treatment plant0.028169
stomach neoplasm0.028169
gastric carcinoma0.028169
bogota0.028169
LOWER IN municipality of santiago de cali0.028169
LOWER IN bucaramanga0.028169
LOWER IN barranquilla0.028169
nephrolithiasis0.028169
age 1-20.028169
LOWER IN age 0-10.028169
bangladesh0.028169
nanchang city prefecture0.028169
LOWER IN pancreatitis0.028169
LOWER IN acute pancreatitis0.028169
LOWER IN nepal0.028169
LOWER IN himalayas0.028169
nanger granti0.028169
kenya0.028169
tropical grassland biome0.028169
gazelle0.028169
LOWER IN short bowel syndrome0.028169
sea urchin0.028169
artificial seawater0.028169
africa0.028169
LOWER IN amerindian0.028169
LOWER IN hunter gatherer0.028169
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN ulcerative colitis0.714286
LOWER IN crohn's disease0.555556
high hdl0.500000
LOWER IN low hdl0.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
age<17 years0.500000
commonwealth of pennsylvania0.500000
taipei city0.500000
taiwan0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
age 60-790.500000
age 30-500.500000
age >940.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
age 13-140.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
low anterior resection0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
stomach neoplasm0.500000
gastric carcinoma0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
india0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
LOWER IN short bowel syndrome0.500000
sea urchin0.500000
artificial seawater0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
children0.500000
new delhi0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN mouth mucosa0.500000
chuquisaca department0.500000
age 5-13 years0.500000
forearm0.500000
LOWER IN rural community0.400000
LOWER IN diabetes mellitus0.333333
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
lean body mass0.333333
low bmi0.333333
caloric restriction diet0.333333
state of oklahoma0.333333
state of texas0.333333
south america0.333333
zhejiang province0.333333
medellin metropolitan area0.333333
jiangxi province0.333333
lytechinus variegatus0.333333
LOWER IN american diet0.333333
terminal ileum0.333333
age > 1 year0.333333
arm0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.942029
feces0.913043
adult0.463768
united states of america0.376812
control0.275362
china0.231884
city0.115942
child0.115942
jiangsu province0.086957
LOWER IN crohn's disease0.072464
LOWER IN ulcerative colitis0.072464
colombia0.057971
infant0.057971
age0.057971
obsolete_juvenile stage0.043478
rural community0.043478
india0.043478
age<17 years0.028986
atlanta0.028986
commonwealth of virginia0.028986
state of california0.028986
commonwealth of pennsylvania0.028986
taipei city0.028986
taiwan0.028986
low bmi0.028986
LOWER IN high bmi0.028986
female0.028986
LOWER IN male0.028986
czech republic0.028986
age 60-790.028986
age 30-500.028986
age >940.028986
cron diet0.028986
caloric restriction diet0.028986
united kingdom0.028986
LOWER IN rural community0.028986
LOWER IN age < 1 year0.028986
age 50-60 years0.028986
nanning city prefecture0.028986
corn and soybean diet0.028986
age 4-7 weeks0.028986
weaned0.028986
jiangxi province0.028986
farm0.028986
sus scrofa0.028986
pig0.028986
LOWER IN mouth mucosa0.028986
LOWER IN mouth0.028986
chuquisaca department0.028986
bolivia0.028986
age 5-13 years0.028986
high hdl0.014493
LOWER IN low hdl0.014493
jordan0.014493
LOWER IN type i diabetes mellitus0.014493
LOWER IN diabetes mellitus0.014493
LOWER IN systemic lupus erythematosus0.014493
lean body mass0.014493
age 8-120.014493
LOWER IN child0.014493
LOWER IN inflammatory bowel disease0.014493
age 3-60.014493
south korea0.014493
kingdom of norway0.014493
oslo0.014493
age 30-400.014493
age 13-140.014493
thailand0.014493
hmong0.014493
LOWER IN karen0.014493
LOWER IN myanmar0.014493
cholelithiasis0.014493
kingdom of spain0.014493
bile0.014493
gallbladder0.014493
state of oklahoma0.014493
LOWER IN peru0.014493
LOWER IN small village0.014493
LOWER IN tunapuco0.014493
low anterior resection0.014493
age 1-3 years0.014493
state of texas0.014493
south america0.014493
low income0.014493
LOWER IN sewer0.014493
LOWER IN wastewater treatment plant0.014493
brazil0.014493
LOWER IN control0.014493
stomach neoplasm0.014493
gastric carcinoma0.014493
stomach0.014493
zhejiang province0.014493
medellin metropolitan area0.014493
bogota0.014493
LOWER IN municipality of santiago de cali0.014493
LOWER IN bucaramanga0.014493
LOWER IN barranquilla0.014493
nephrolithiasis0.014493
age 1-20.014493
LOWER IN age 0-10.014493
Exp. ID User ID Description Date Region Flag Sequences
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
532amnoncommon control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 98
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org