Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.424207
feces0.414583
adult0.345265
child0.194463
china0.184271
rural community0.136519
united states of america0.130763
control0.121387
sus scrofa0.120603
pig0.120603
obsolete_juvenile stage0.118812
city0.102433
infant0.090791
india0.086957
monkey0.078431
united kingdom0.076923
small village0.073710
caecum0.069364
jiangsu province0.067114
farm0.063391
research facility0.061935
age 5-13 years0.059259
guangzhou city prefecture0.058394
himalayas0.058394
nepal0.056738
czech republic0.056738
rat0.055172
age0.054054
kingdom of spain0.047337
metabolic syndrome0.044944
ireland0.044444
zambia0.044444
chuquisaca department0.044444
ulcerative colitis0.044118
LOWER IN duodenum0.043796
kingdom of denmark0.043478
LOWER IN crohn's disease0.043478
rattus0.043478
left colon0.042553
ethiopia0.042553
bolivia0.042553
right colon0.041667
state of tennessee0.041667
bos taurus0.041237
rumen0.040816
river0.040816
state of florida0.040404
belgium0.040000
zoological garden0.039216
wild0.036364
skin0.036036
water0.030303
tursiops truncatus0.030075
bottlenosed dolphin0.030075
irritable bowel syndrome0.030075
canada0.030075
atherosclerosis0.030075
raji0.030075
stroke0.030075
oslo0.030075
new delhi0.030075
nanchang city prefecture0.030075
age 19-240.030075
papio kindae0.030075
papio ursinus0.030075
el salvador0.030075
age 130.030075
LOWER IN age < 1 year0.030075
age 50-60 years0.030075
nanning city prefecture0.030075
sea urchin0.030075
tunapuco0.030075
hunter gatherer0.030075
jiulong river0.030075
fujian province0.030075
chlorocebus aethiops0.030075
LOWER IN mouth mucosa0.030075
holstein-friesian bull0.030075
tonsil0.029630
obesity0.029630
lytechinus variegatus0.029630
peru0.029630
wistar rat0.029630
depth 0.5m0.029630
finland0.029412
juvenile organism0.029197
crohn's disease0.028986
rectum0.028986
colombia0.028777
egypt0.028777
commonwealth of virginia0.028777
age 4 weeks0.028777
age 1 year0.028369
state of michigan0.027972
LOWER IN mouth0.027972
kingdom of norway0.027586
female0.024691
fresh water0.024242
mus musculus0.021622
LOWER IN control0.015873
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
metabolic syndrome0.666667
age 5-13 years0.666667
india0.666667
rural community0.571429
low hdl0.500000
LOWER IN high hdl0.500000
tursiops truncatus0.500000
bottlenosed dolphin0.500000
irritable bowel syndrome0.500000
canada0.500000
atherosclerosis0.500000
guangzhou city prefecture0.500000
himalayas0.500000
raji0.500000
stroke0.500000
commonwealth of pennsylvania0.500000
inflammatory bowel disease0.500000
oslo0.500000
quito0.500000
new delhi0.500000
jordan0.500000
barranquilla0.500000
bucaramanga0.500000
municipality of santiago de cali0.500000
LOWER IN bogota0.500000
LOWER IN medellin metropolitan area0.500000
tharu0.500000
agrarian0.500000
denver0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
chepang0.500000
age 19-240.500000
intestinal contents0.500000
lamb0.500000
ireland0.500000
age 100 days0.500000
age 8-120.500000
age 3-60.500000
age 30-500.500000
age >940.500000
cron diet0.500000
age 13-140.500000
obese body mass index status0.500000
db/db mouse0.500000
LOWER IN russia0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio kindae0.500000
papio ursinus0.500000
LOWER IN papio anubis0.500000
el salvador0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
age 130.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
kinda baboon0.500000
grayfoot chacma baboon0.500000
toronto0.500000
male0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sea urchin0.500000
eagle harbor0.500000
dahl salt-sensitive0.500000
salt rich diet0.500000
salt0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
hadza0.500000
hunter gatherer0.500000
LOWER IN short bowel syndrome0.500000
artificial seawater0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
cecal content0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.821705
homo sapiens0.713178
adult0.379845
china0.240310
united states of america0.201550
control0.162791
child0.124031
rural community0.077519
obsolete_juvenile stage0.069767
sus scrofa0.069767
pig0.069767
city0.062016
research facility0.062016
infant0.054264
caecum0.046512
united kingdom0.046512
india0.046512
monkey0.046512
farm0.038760
jiangsu province0.038760
small village0.038760
kingdom of spain0.031008
guangzhou city prefecture0.031008
himalayas0.031008
nepal0.031008
age 5-13 years0.031008
czech republic0.031008
age0.031008
rat0.031008
skin0.023256
right colon0.023256
left colon0.023256
belgium0.023256
ulcerative colitis0.023256
kingdom of denmark0.023256
metabolic syndrome0.023256
rumen0.023256
ireland0.023256
zambia0.023256
wild0.023256
LOWER IN crohn's disease0.023256
LOWER IN duodenum0.023256
rattus0.023256
state of florida0.023256
zoological garden0.023256
state of tennessee0.023256
river0.023256
water0.023256
ethiopia0.023256
bolivia0.023256
chuquisaca department0.023256
bos taurus0.023256
colombia0.015504
tursiops truncatus0.015504
bottlenosed dolphin0.015504
irritable bowel syndrome0.015504
egypt0.015504
canada0.015504
atherosclerosis0.015504
raji0.015504
stroke0.015504
crohn's disease0.015504
kingdom of norway0.015504
oslo0.015504
age 1 year0.015504
commonwealth of virginia0.015504
new delhi0.015504
state of michigan0.015504
tonsil0.015504
age 4 weeks0.015504
nanchang city prefecture0.015504
female0.015504
age 19-240.015504
mus musculus0.015504
obesity0.015504
finland0.015504
papio kindae0.015504
papio ursinus0.015504
el salvador0.015504
age 130.015504
juvenile organism0.015504
LOWER IN age < 1 year0.015504
rectum0.015504
age 50-60 years0.015504
nanning city prefecture0.015504
sea urchin0.015504
lytechinus variegatus0.015504
peru0.015504
tunapuco0.015504
wistar rat0.015504
hunter gatherer0.015504
LOWER IN control0.015504
fresh water0.015504
depth 0.5m0.015504
jiulong river0.015504
fujian province0.015504
chlorocebus aethiops0.015504
LOWER IN mouth mucosa0.015504
LOWER IN mouth0.015504
holstein-friesian bull0.015504
Exp. ID User ID Description Date Region Flag Sequences
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
79amnonhighfreq skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
79amnoncommon skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
294amnonhighfreq homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
256amnonhighfreq sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
292amnonhighfreq homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
566amnonhighfreq adult, homo sapiens, china, feces2019-11-24v4No1 / 24
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
562amnonhighfreq age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 28
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
18amnon high in equus przewalskii compared to equus caballus in feces 2016-11-14v4No1 / 1542
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
137amnoncommon gopherus polyphemus, gopher tortoise, feces, united states of america, state of florida2017-04-17v4No1 / 1622

Problems / suggestions? Please email info AT dbbact DOT org