Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.428691
feces0.407769
adult0.336996
child0.191235
china0.176829
rural community0.140351
united states of america0.127820
control0.126697
sus scrofa0.123924
pig0.123924
obsolete_juvenile stage0.122034
city0.105125
infant0.093209
india0.089552
monkey0.080537
united kingdom0.078947
small village0.075949
caecum0.071856
jiangsu province0.068966
farm0.065574
research facility0.062910
himalayas0.060150
guangzhou city prefecture0.060150
czech republic0.059259
nepal0.058394
rat0.056738
age0.055556
kingdom of spain0.048485
metabolic syndrome0.046332
ireland0.045802
zambia0.045802
chuquisaca department0.045802
age 5-13 years0.045802
ulcerative colitis0.045455
LOWER IN duodenum0.045455
kingdom of denmark0.044776
LOWER IN crohn's disease0.044776
rattus0.044776
left colon0.043796
ethiopia0.043796
bolivia0.043796
right colon0.042857
rumen0.042857
zoological garden0.042857
state of tennessee0.042857
bos taurus0.042857
belgium0.041958
river0.041958
skin0.037267
wild0.037267
water0.031169
tursiops truncatus0.031008
bottlenosed dolphin0.031008
irritable bowel syndrome0.031008
atherosclerosis0.031008
raji0.031008
stroke0.031008
oslo0.031008
new delhi0.031008
nanchang city prefecture0.031008
age 19-240.031008
papio kindae0.031008
papio ursinus0.031008
el salvador0.031008
age 130.031008
LOWER IN age < 1 year0.031008
age 50-60 years0.031008
nanning city prefecture0.031008
sea urchin0.031008
tunapuco0.031008
hunter gatherer0.031008
depth 0.5m0.031008
jiulong river0.031008
fujian province0.031008
chlorocebus aethiops0.031008
LOWER IN mouth mucosa0.031008
holstein-friesian bull0.031008
egypt0.030534
tonsil0.030534
obesity0.030534
lytechinus variegatus0.030534
peru0.030534
wistar rat0.030534
finland0.030303
juvenile organism0.030075
crohn's disease0.029851
rectum0.029851
colombia0.029630
commonwealth of virginia0.029630
age 4 weeks0.029630
age 1 year0.029197
state of florida0.029197
state of michigan0.028777
LOWER IN mouth0.028777
kingdom of norway0.028369
canada0.026144
female0.025478
fresh water0.025157
mus musculus0.022099
LOWER IN control0.016529
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
metabolic syndrome0.666667
india0.666667
rural community0.571429
low hdl0.500000
LOWER IN high hdl0.500000
tursiops truncatus0.500000
bottlenosed dolphin0.500000
irritable bowel syndrome0.500000
atherosclerosis0.500000
himalayas0.500000
raji0.500000
guangzhou city prefecture0.500000
commonwealth of pennsylvania0.500000
inflammatory bowel disease0.500000
stroke0.500000
oslo0.500000
new delhi0.500000
jordan0.500000
barranquilla0.500000
bucaramanga0.500000
municipality of santiago de cali0.500000
LOWER IN bogota0.500000
LOWER IN medellin metropolitan area0.500000
tharu0.500000
agrarian0.500000
denver0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
azerbaijan0.500000
chepang0.500000
age 19-240.500000
intestinal contents0.500000
lamb0.500000
ireland0.500000
age 100 days0.500000
age 8-120.500000
age 3-60.500000
age 30-500.500000
age >940.500000
cron diet0.500000
age 13-140.500000
obese body mass index status0.500000
db/db mouse0.500000
LOWER IN russia0.500000
zambia0.500000
baboon0.500000
papio0.500000
papio kindae0.500000
papio ursinus0.500000
LOWER IN papio anubis0.500000
el salvador0.500000
age<17 years0.500000
LOWER IN age 1-3 weeks0.500000
age 130.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
kinda baboon0.500000
grayfoot chacma baboon0.500000
toronto0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sea urchin0.500000
eagle harbor0.500000
dahl salt-sensitive0.500000
salt rich diet0.500000
salt0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
hadza0.500000
hunter gatherer0.500000
LOWER IN short bowel syndrome0.500000
artificial seawater0.500000
depth 0.5m0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
cecal content0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.816000
homo sapiens0.712000
adult0.368000
china0.232000
united states of america0.200000
control0.168000
child0.120000
rural community0.080000
obsolete_juvenile stage0.072000
sus scrofa0.072000
pig0.072000
city0.064000
research facility0.064000
infant0.056000
united kingdom0.048000
caecum0.048000
india0.048000
monkey0.048000
farm0.040000
jiangsu province0.040000
small village0.040000
kingdom of spain0.032000
himalayas0.032000
nepal0.032000
guangzhou city prefecture0.032000
czech republic0.032000
age0.032000
rat0.032000
skin0.024000
right colon0.024000
left colon0.024000
belgium0.024000
ulcerative colitis0.024000
kingdom of denmark0.024000
metabolic syndrome0.024000
rumen0.024000
ireland0.024000
zambia0.024000
wild0.024000
LOWER IN crohn's disease0.024000
LOWER IN duodenum0.024000
rattus0.024000
zoological garden0.024000
state of tennessee0.024000
river0.024000
water0.024000
ethiopia0.024000
chuquisaca department0.024000
bolivia0.024000
age 5-13 years0.024000
bos taurus0.024000
colombia0.016000
tursiops truncatus0.016000
bottlenosed dolphin0.016000
irritable bowel syndrome0.016000
egypt0.016000
canada0.016000
atherosclerosis0.016000
raji0.016000
crohn's disease0.016000
stroke0.016000
kingdom of norway0.016000
oslo0.016000
age 1 year0.016000
commonwealth of virginia0.016000
new delhi0.016000
state of michigan0.016000
tonsil0.016000
age 4 weeks0.016000
nanchang city prefecture0.016000
female0.016000
age 19-240.016000
mus musculus0.016000
obesity0.016000
finland0.016000
papio kindae0.016000
papio ursinus0.016000
el salvador0.016000
age 130.016000
juvenile organism0.016000
LOWER IN age < 1 year0.016000
rectum0.016000
age 50-60 years0.016000
nanning city prefecture0.016000
sea urchin0.016000
lytechinus variegatus0.016000
state of florida0.016000
peru0.016000
tunapuco0.016000
wistar rat0.016000
hunter gatherer0.016000
LOWER IN control0.016000
fresh water0.016000
depth 0.5m0.016000
jiulong river0.016000
fujian province0.016000
chlorocebus aethiops0.016000
LOWER IN mouth mucosa0.016000
LOWER IN mouth0.016000
holstein-friesian bull0.016000
Exp. ID User ID Description Date Region Flag Sequences
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
79amnonhighfreq skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
79amnoncommon skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
294amnonhighfreq homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
256amnonhighfreq sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 19
292amnonhighfreq homo sapiens, china, adult, feces, control2018-02-05v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 20
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, stroke)2018-05-15v4No1 / 22
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
292amnoncommon homo sapiens, china, adult, feces, ulcerative colitis2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
532amnoncommon control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obesity, obese body mass index status, db/db mouse2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
349amnoncommon rattus, rat, feces, china, research facility, sprague dawley, male2018-07-29v4No1 / 235
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to colitis dnbs induced colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
18amnon high in equus przewalskii compared to equus caballus in feces 2016-11-14v4No1 / 1542
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in beetle whole body 2019-04-19v4No1 / 1543
137amnoncommon gopherus polyphemus, gopher tortoise, feces, florida, united states of america2017-04-17v4No1 / 1622

Problems / suggestions? Please email info AT dbbact DOT org