Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTCATCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.595170
feces0.544170
adult0.423529
united states of america0.297030
canis lupus familiaris0.195122
dog0.160494
china0.137157
control0.129683
child0.121704
city0.111455
rectum0.094213
infant0.090909
age0.077419
jiangsu province0.075000
biopsy0.069284
state of colorado0.067720
state of oklahoma0.056338
heterosexual0.056338
msw0.056338
obsolete_juvenile stage0.053571
australia0.051282
female0.047619
colon0.046512
LOWER IN age < 1 year0.042857
LOWER IN rural community0.042553
biopsy site0.042254
age >940.042254
state of michigan0.041958
LOWER IN ulcerative colitis0.041958
high bmi0.041667
diarrhea0.040956
kingdom of norway0.040541
italy0.040134
united kingdom0.040134
kingdom of spain0.039735
LOWER IN control0.031621
age > 1 year0.028777
metabolic syndrome0.028777
LOWER IN gay0.028777
LOWER IN msm0.028777
LOWER IN homosexual0.028777
canis mesomelas0.028571
native american0.028571
arapaho0.028571
cheyenne0.028571
lycaon pictus0.028571
african wild dog0.028571
oslo0.028571
sigmoid colon0.028571
children0.028571
guangzhou city prefecture0.028571
commonwealth of pennsylvania0.028571
denver0.028571
LOWER IN exocrine pancreatic insufficiency0.028571
cat0.028571
age 60-790.028571
age 30-500.028571
toronto0.028571
LOWER IN small village0.028571
age 50-60 years0.028571
nanning city prefecture0.028571
africa0.028571
body mass index0.028369
namibia0.028169
terminal ileum0.028169
american diet0.028169
LOWER IN low bmi0.028169
felis catus0.028169
LOWER IN child0.028169
india0.028169
kingdom of denmark0.028169
LOWER IN duodenum0.027972
rural community0.027972
south korea0.027778
duodenum0.027778
ileum0.027778
LOWER IN ileum0.027778
crohn's disease0.027586
LOWER IN crohn's disease0.027586
sus scrofa0.027586
pig0.027586
commonwealth of virginia0.027397
south africa0.027027
hospital0.027027
state of california0.025806
diet0.025157
skin0.025000
caecum0.022472
research facility0.017167
new york county0.014493
chronic fatigue syndrome0.014493
exocrine pancreatic insufficiency0.014493
enzyme supplement0.014493
LOWER IN no enzyme supplement0.014493
endospore enriched fraction0.014493
lysis0.014493
LOWER IN plant based diet0.014493
LOWER IN milk0.014493
age 30-50 years0.014493
LOWER IN age 50-80 years0.014493
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN age < 1 year0.750000
state of oklahoma0.666667
age > 1 year0.666667
heterosexual0.666667
msw0.666667
metabolic syndrome0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
biopsy0.600000
LOWER IN rural community0.600000
canis lupus familiaris0.571429
rectum0.555556
canis mesomelas0.500000
new york county0.500000
chronic fatigue syndrome0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
lycaon pictus0.500000
african wild dog0.500000
dog0.500000
exocrine pancreatic insufficiency0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
endospore enriched fraction0.500000
lysis0.500000
LOWER IN plant based diet0.500000
LOWER IN milk0.500000
age 30-50 years0.500000
LOWER IN age 50-80 years0.500000
oslo0.500000
sigmoid colon0.500000
children0.500000
stroke0.500000
guangzhou city prefecture0.500000
salmonella gastroenteritis0.500000
LOWER IN lymphoma0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
LOWER IN cron diet0.500000
schizophrenia0.500000
jordan0.500000
iowa0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
panthera leo0.500000
lion0.500000
denver0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
LOWER IN enzyme supplementation0.500000
cat0.500000
city of melbourne0.500000
age 200.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
biopsy site0.500000
age 19-240.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
beagle dog0.500000
age 30-400.500000
age 13-140.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
toronto0.500000
glasgow0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 1-3 years0.500000
spondylitis0.500000
spondyloarthritis0.500000
stomach neoplasm0.500000
gastric carcinoma0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
corn and soybean diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.875000
homo sapiens0.801471
united states of america0.477941
adult0.375000
china0.161765
control0.132353
canis lupus familiaris0.117647
dog0.095588
child0.073529
city0.066176
infant0.051471
rectum0.051471
age0.044118
jiangsu province0.044118
biopsy0.036765
state of colorado0.036765
LOWER IN control0.029412
state of oklahoma0.029412
australia0.029412
colon0.029412
obsolete_juvenile stage0.029412
heterosexual0.029412
msw0.029412
female0.029412
state of michigan0.022059
diarrhea0.022059
LOWER IN age < 1 year0.022059
kingdom of norway0.022059
italy0.022059
united kingdom0.022059
high bmi0.022059
biopsy site0.022059
LOWER IN ulcerative colitis0.022059
kingdom of spain0.022059
age >940.022059
LOWER IN rural community0.022059
namibia0.014706
canis mesomelas0.014706
native american0.014706
arapaho0.014706
cheyenne0.014706
south africa0.014706
lycaon pictus0.014706
african wild dog0.014706
crohn's disease0.014706
diet0.014706
age > 1 year0.014706
hospital0.014706
south korea0.014706
oslo0.014706
terminal ileum0.014706
sigmoid colon0.014706
caecum0.014706
children0.014706
duodenum0.014706
guangzhou city prefecture0.014706
commonwealth of virginia0.014706
american diet0.014706
ileum0.014706
commonwealth of pennsylvania0.014706
body mass index0.014706
LOWER IN low bmi0.014706
LOWER IN duodenum0.014706
LOWER IN ileum0.014706
denver0.014706
LOWER IN exocrine pancreatic insufficiency0.014706
state of california0.014706
felis catus0.014706
cat0.014706
metabolic syndrome0.014706
LOWER IN gay0.014706
LOWER IN msm0.014706
LOWER IN homosexual0.014706
LOWER IN child0.014706
LOWER IN crohn's disease0.014706
age 60-790.014706
age 30-500.014706
research facility0.014706
rural community0.014706
toronto0.014706
LOWER IN small village0.014706
age 50-60 years0.014706
nanning city prefecture0.014706
india0.014706
sus scrofa0.014706
pig0.014706
skin0.014706
kingdom of denmark0.014706
africa0.014706
new york county0.007353
chronic fatigue syndrome0.007353
clostridium difficile intestinal infectious disease0.007353
exocrine pancreatic insufficiency0.007353
enzyme supplement0.007353
LOWER IN no enzyme supplement0.007353
endospore enriched fraction0.007353
lysis0.007353
animal product diet0.007353
LOWER IN plant based diet0.007353
breast milk0.007353
Exp. ID User ID Description Date Region Flag Sequences
15amnonhighfreq namibia, feces, canis mesomelas2016-11-08v4No1 / 16
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
242amnonhigh freq. in native-americans (highfreq homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
406amnonhighfreq feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in canis lupus familiaris dog feces united states of america exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to milk in homo sapiens feces infant )2016-12-01v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-16v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 47
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 59
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
301amnon high in colon rectum compared to duodenum ileum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to exocrine pancreatic insufficiency enzyme supplementation in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org