Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTCAAACTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.448770
feces0.360240
adult0.353247
rural community0.250000
child0.199336
china0.113924
control0.113587
thailand0.108696
hunter gatherer0.091603
small village0.091603
united states of america0.091503
infant0.090634
africa0.088889
chuquisaca department0.088889
age 5-13 years0.088889
LOWER IN crohn's disease0.087912
jiangsu province0.081633
bolivia0.081633
colombia0.068966
hmong0.068182
cron diet0.068182
age 50-60 years0.068182
nanning city prefecture0.068182
age 60-790.068182
age 30-500.068182
caloric restriction diet0.065934
monkey0.064865
pig0.063830
sus scrofa0.063830
obsolete_juvenile stage0.061856
age0.059406
city0.057416
female0.057143
metabolic syndrome0.047059
amerindian0.047059
venezuela0.047059
nepal0.046512
himalayas0.046512
central african republic0.046512
bangui0.046512
denver0.046512
nanchang city prefecture0.046512
left colon0.046512
hadza0.046512
LOWER IN age < 1 year0.046512
tunapuco0.046512
LOWER IN mouth mucosa0.046512
holstein-friesian bull0.046512
biopsy0.045977
LOWER IN child0.045977
LOWER IN infant0.045977
homosexual0.045455
gay0.045455
msm0.045455
age < 3 years0.045455
tanzania0.045455
peru0.045455
kingdom of denmark0.045455
ethiopia0.045455
LOWER IN ulcerative colitis0.044944
LOWER IN finland0.044444
LOWER IN united states of america0.044444
ireland0.044444
rectum0.043956
state of colorado0.042553
LOWER IN mouth0.041667
bos taurus0.040000
united kingdom0.039216
rumen0.039216
caecum0.038835
diet0.038095
gastric bypass0.023810
madagascar0.023810
antananarivo0.023810
tharu0.023810
agrarian0.023810
LOWER IN nephrolithiasis0.023810
metabolic syndrome x0.023810
azerbaijan0.023810
chepang0.023810
age 19-240.023810
age >940.023810
LOWER IN gangcha region0.023810
gannan tibetan autonomous prefecture0.023810
glasgow0.023810
myanmar0.023810
karen0.023810
age 13-140.023810
LOWER IN karen0.023810
LOWER IN myanmar0.023810
oslo0.023810
age 30-400.023810
kebbi state0.023810
age 10-15 years0.023810
el salvador0.023810
estonia0.023810
LOWER IN age 1-3 weeks0.023810
age 1-3 years0.023810
low income0.023810
LOWER IN sewer0.023810
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.857143
hunter gatherer0.750000
small village0.750000
metabolic syndrome0.666667
amerindian0.666667
venezuela0.666667
colombia0.600000
thailand0.500000
hmong0.500000
gastric bypass0.500000
cron diet0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
nepal0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
central african republic0.500000
bangui0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
denver0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
chepang0.500000
age 19-240.500000
age 60-790.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 30-500.500000
left colon0.500000
age >940.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
glasgow0.500000
myanmar0.500000
karen0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
oslo0.500000
age 30-400.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
LOWER IN age >940.500000
atherosclerosis0.500000
zambia0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
nephrolithiasis0.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
terminal ileum0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
LOWER IN mouth mucosa0.500000
holstein-friesian bull0.500000
forearm0.500000
LOWER IN restricted diet0.500000
LOWER IN crohn's disease0.444444
biopsy0.400000
LOWER IN child0.400000
LOWER IN infant0.400000
caloric restriction diet0.333333
homosexual0.333333
gay0.333333
msm0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.890244
feces0.890244
adult0.414634
china0.219512
united states of america0.170732
control0.158537
child0.146341
rural community0.146341
thailand0.060976
infant0.060976
female0.048780
africa0.048780
jiangsu province0.048780
chuquisaca department0.048780
bolivia0.048780
age 5-13 years0.048780
hunter gatherer0.048780
LOWER IN crohn's disease0.048780
small village0.048780
hmong0.036585
cron diet0.036585
caloric restriction diet0.036585
colombia0.036585
city0.036585
age 50-60 years0.036585
nanning city prefecture0.036585
obsolete_juvenile stage0.036585
age 60-790.036585
age 30-500.036585
pig0.036585
sus scrofa0.036585
age0.036585
monkey0.036585
LOWER IN ulcerative colitis0.024390
nepal0.024390
himalayas0.024390
central african republic0.024390
bangui0.024390
state of colorado0.024390
denver0.024390
homosexual0.024390
gay0.024390
msm0.024390
metabolic syndrome0.024390
nanchang city prefecture0.024390
left colon0.024390
biopsy0.024390
amerindian0.024390
venezuela0.024390
LOWER IN child0.024390
LOWER IN infant0.024390
age < 3 years0.024390
LOWER IN finland0.024390
tanzania0.024390
hadza0.024390
LOWER IN age < 1 year0.024390
rectum0.024390
peru0.024390
tunapuco0.024390
kingdom of denmark0.024390
LOWER IN united states of america0.024390
united kingdom0.024390
diet0.024390
ethiopia0.024390
caecum0.024390
LOWER IN mouth mucosa0.024390
LOWER IN mouth0.024390
bos taurus0.024390
rumen0.024390
holstein-friesian bull0.024390
ireland0.024390
gastric bypass0.012195
LOWER IN control0.012195
state of california0.012195
madagascar0.012195
antananarivo0.012195
tharu0.012195
agrarian0.012195
LOWER IN nephrolithiasis0.012195
metabolic syndrome x0.012195
azerbaijan0.012195
forager0.012195
chepang0.012195
age 19-240.012195
biopsy site0.012195
age >940.012195
tibet autonomous region0.012195
tibetan plateau0.012195
LOWER IN gangcha region0.012195
gannan tibetan autonomous prefecture0.012195
LOWER IN heterosexual0.012195
LOWER IN msw0.012195
glasgow0.012195
LOWER IN obsolete_juvenile stage0.012195
south korea0.012195
myanmar0.012195
karen0.012195
age 13-140.012195
LOWER IN karen0.012195
LOWER IN myanmar0.012195
Exp. ID User ID Description Date Sequences
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-181 / 13
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-231 / 17
293amnonhighfreq homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-071 / 18
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-061 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-081 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-281 / 74
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-201 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-081 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-051 / 81
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-271 / 83
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-311 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-241 / 88
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-091 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-181 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-071 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-301 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-281 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-301 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-281 / 103
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-301 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-291 / 113
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-301 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-221 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-061 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-301 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-031 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-311 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-091 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-261 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-161 / 128
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-181 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-071 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-301 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-181 / 135
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-131 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-181 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-211 / 155
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-131 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-051 / 161
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-041 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-041 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-131 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-181 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-211 / 188
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-301 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-121 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-101 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-011 / 218
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-231 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-071 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-271 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-151 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-131 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-221 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-271 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-091 / 288
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-131 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-041 / 311
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-141 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-131 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-181 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-261 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-071 / 381
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-081 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-131 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-161 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-271 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-241 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-141 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-221 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-301 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-161 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-261 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-141 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-081 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-121 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-201 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 606
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 752
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-051 / 757
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-051 / 1023

Problems / suggestions? Please email info AT dbbact DOT org