Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTCAAACTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.437061
feces0.355623
adult0.352600
rural community0.240000
child0.185759
china0.134003
control0.107438
thailand0.104167
united states of america0.087799
hunter gatherer0.087591
small village0.087591
infant0.086207
africa0.085106
chuquisaca department0.085106
age 5-13 years0.085106
LOWER IN crohn's disease0.084211
pig0.081633
sus scrofa0.081633
jiangsu province0.078431
bolivia0.078431
colombia0.065934
hmong0.065217
cron diet0.065217
age 50-60 years0.065217
nanning city prefecture0.065217
age 60-790.065217
age 30-500.065217
caloric restriction diet0.063158
monkey0.061224
obsolete_juvenile stage0.059406
age0.057143
city0.053812
female0.053333
metabolic syndrome0.044944
amerindian0.044944
venezuela0.044944
himalayas0.044444
central african republic0.044444
bangui0.044444
denver0.044444
nanchang city prefecture0.044444
left colon0.044444
hadza0.044444
LOWER IN age < 1 year0.044444
tunapuco0.044444
LOWER IN mouth mucosa0.044444
holstein-friesian bull0.044444
biopsy0.043956
LOWER IN infant0.043956
nepal0.043478
homosexual0.043478
gay0.043478
msm0.043478
LOWER IN child0.043478
age < 3 years0.043478
tanzania0.043478
peru0.043478
kingdom of denmark0.043478
LOWER IN ulcerative colitis0.043011
LOWER IN finland0.042553
LOWER IN united states of america0.042553
ethiopia0.042553
ireland0.042553
rectum0.042105
kingdom of spain0.041667
state of colorado0.040000
LOWER IN mouth0.040000
united kingdom0.038462
bos taurus0.037736
farm0.037037
caecum0.037037
rumen0.037037
diet0.036364
LOWER IN control0.029268
gastric bypass0.022727
madagascar0.022727
antananarivo0.022727
tharu0.022727
agrarian0.022727
LOWER IN nephrolithiasis0.022727
metabolic syndrome x0.022727
azerbaijan0.022727
chepang0.022727
age 19-240.022727
age >940.022727
LOWER IN gangcha region0.022727
gannan tibetan autonomous prefecture0.022727
glasgow0.022727
cholelithiasis0.022727
bile0.022727
gallbladder0.022727
myanmar0.022727
karen0.022727
age 13-140.022727
LOWER IN karen0.022727
LOWER IN myanmar0.022727
oslo0.022727
age 30-400.022727
kebbi state0.022727
age 10-15 years0.022727
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.857143
hunter gatherer0.750000
small village0.750000
metabolic syndrome0.666667
amerindian0.666667
venezuela0.666667
colombia0.600000
thailand0.500000
hmong0.500000
gastric bypass0.500000
cron diet0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
central african republic0.500000
bangui0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
denver0.500000
metabolic syndrome x0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
chepang0.500000
age 19-240.500000
age 60-790.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 30-500.500000
left colon0.500000
age >940.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
glasgow0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
myanmar0.500000
karen0.500000
age 13-140.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
oslo0.500000
age 30-400.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
low anterior resection0.500000
taipei city0.500000
taiwan0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
LOWER IN age >940.500000
stomach neoplasm0.500000
gastric carcinoma0.500000
atherosclerosis0.500000
zambia0.500000
papio ursinus0.500000
grayfoot chacma baboon0.500000
nephrolithiasis0.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN age 4-7 weeks0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN weaned0.500000
age 2-4 weeks0.500000
preweaned0.500000
suckling0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
sigmoid colon0.500000
children0.500000
LOWER IN state of oklahoma0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
age one year0.500000
LOWER IN age one month0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.883721
feces0.872093
adult0.430233
china0.232558
united states of america0.162791
control0.151163
child0.139535
rural community0.139535
thailand0.058140
infant0.058140
female0.046512
africa0.046512
jiangsu province0.046512
chuquisaca department0.046512
bolivia0.046512
age 5-13 years0.046512
hunter gatherer0.046512
LOWER IN crohn's disease0.046512
small village0.046512
pig0.046512
sus scrofa0.046512
hmong0.034884
LOWER IN control0.034884
cron diet0.034884
caloric restriction diet0.034884
colombia0.034884
city0.034884
age 50-60 years0.034884
nanning city prefecture0.034884
obsolete_juvenile stage0.034884
age 60-790.034884
age 30-500.034884
age0.034884
monkey0.034884
LOWER IN ulcerative colitis0.023256
nepal0.023256
himalayas0.023256
central african republic0.023256
bangui0.023256
state of colorado0.023256
denver0.023256
homosexual0.023256
gay0.023256
msm0.023256
metabolic syndrome0.023256
nanchang city prefecture0.023256
left colon0.023256
biopsy0.023256
amerindian0.023256
venezuela0.023256
LOWER IN child0.023256
kingdom of spain0.023256
LOWER IN infant0.023256
age < 3 years0.023256
LOWER IN finland0.023256
farm0.023256
tanzania0.023256
hadza0.023256
LOWER IN age < 1 year0.023256
rectum0.023256
peru0.023256
tunapuco0.023256
kingdom of denmark0.023256
LOWER IN united states of america0.023256
united kingdom0.023256
diet0.023256
ethiopia0.023256
caecum0.023256
LOWER IN mouth mucosa0.023256
LOWER IN mouth0.023256
bos taurus0.023256
rumen0.023256
holstein-friesian bull0.023256
ireland0.023256
gastric bypass0.011628
state of california0.011628
madagascar0.011628
antananarivo0.011628
tharu0.011628
agrarian0.011628
LOWER IN nephrolithiasis0.011628
metabolic syndrome x0.011628
azerbaijan0.011628
forager0.011628
chepang0.011628
age 19-240.011628
biopsy site0.011628
age >940.011628
tibet autonomous region0.011628
tibetan plateau0.011628
LOWER IN gangcha region0.011628
gannan tibetan autonomous prefecture0.011628
LOWER IN heterosexual0.011628
LOWER IN msw0.011628
glasgow0.011628
LOWER IN obsolete_juvenile stage0.011628
south korea0.011628
cholelithiasis0.011628
bile0.011628
gallbladder0.011628
Exp. ID User ID Description Date Region Flag Sequences
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
293amnonhighfreq homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-27v4No1 / 83
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
526amnon high in cholelithiasis compared to control in kingdom of spain adult bile gallbladder homo sapiens 2019-07-14v3No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in age 2-4 weeks preweaned suckling compared to age 4-7 weeks corn and soybean diet weaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 347
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org