Search result for sequence:
TACGTATGGTGCGAGCGTTATCCGGAATCATTGGGCGTAAAGCGCGCGTAGGCGGCTTGTTAAGCAGGAATTTAAATCTTAGGGCTCAACCTTAAGTCGGTTCCTGAACTGGCAGGCTCGAGTGCGGTAGAGGAAGGTGGAATTCCCAGT
common ontology terms
term enrichment score
TermScore
state of wyoming0.625000
centrocercus urophasianus0.625000
greater sage-grouse0.625000
gizzard0.333333
LOWER IN crop0.142857
size < 10um0.142857
clear day0.142857
dust0.133333
bird0.131579
belgium0.100000
duodenum0.080000
LOWER IN duodenum0.080000
air0.080000
crohn's disease0.076923
colon0.068966
israel0.068966
LOWER IN colon0.057143
caecum0.044444
LOWER IN control0.009901
united states of america0.007686
homo sapiens0.006645
feces0.005602
Fraction of dbbact annotations with this term covered by the query
TermScore
state of wyoming0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
gizzard0.500000
LOWER IN crop0.500000
size < 10um0.500000
clear day0.500000
dust0.333333
belgium0.125000
duodenum0.076923
LOWER IN duodenum0.076923
air0.076923
bird0.071429
crohn's disease0.071429
israel0.058824
colon0.043478
LOWER IN colon0.043478
caecum0.023810
LOWER IN control0.005263
united states of america0.003861
homo sapiens0.003460
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.833333
state of wyoming0.833333
bird0.833333
centrocercus urophasianus0.833333
greater sage-grouse0.833333
caecum0.333333
gizzard0.250000
colon0.166667
duodenum0.083333
crohn's disease0.083333
LOWER IN control0.083333
feces0.083333
homo sapiens0.083333
belgium0.083333
LOWER IN colon0.083333
LOWER IN crop0.083333
LOWER IN duodenum0.083333
air0.083333
dust0.083333
israel0.083333
size < 10um0.083333
clear day0.083333
Exp. ID User ID Description Date Region Flag Sequences
558amnondominant united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 19
558amnondominant united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 23
558amnondominant united states of america, caecum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 26
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
558amnoncommon united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
558amnoncommon united states of america, caecum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 155
558amnon high in caecum compared to colon in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 359
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
558amnon high in caecum compared to duodenum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 488
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765

Problems / suggestions? Please email info AT dbbact DOT org