Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGAAAAATAAGTCTGATGTTAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTTTTTCTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
fresh water0.287405
intestine0.270876
digestive system0.213333
river0.203704
fish0.191972
texas0.188679
water0.186335
hunan province0.184874
snake0.180905
pond0.175182
china0.170940
oreochromis niloticus0.163265
snake farm0.156863
adula0.156863
research facility0.146341
united states of america0.143733
colon0.125874
frog0.124352
nile tilapia0.122449
zebra fish0.118812
danio rerio0.115385
ictalurus punctatus0.106952
channel catfish0.106952
england0.104167
farm0.091667
fish farm0.086957
state of alabama0.085106
mississippi river0.085106
autumn0.080537
state of florida0.075472
fishpond0.066298
cyprinus carpio0.065217
common carp0.065217
quasipaa spinosa0.065217
giant spiny frog0.065217
tadpole0.065217
jiulong river0.065217
fujian province0.065217
aquatic biome0.065217
jiangxi province0.063158
depth 0.5m0.063158
caecum0.061224
saline water0.061224
feces0.060558
state of oregon0.059406
state of minnesota0.057692
city0.057692
summer0.057692
brazil0.054795
sediment0.049793
osteopilus septentrionalis0.044944
c57bl/60.044776
catfish0.044444
freshwater sediment metagenome0.044444
tilapia0.044444
elaphe carinata0.044444
king ratsnake0.044444
naja atra0.044444
chinese cobra0.044444
ptyas mucosa0.044444
oriental ratsnake0.044444
deinagkistrodon acutus0.044444
pit viper0.044444
saline water aquarium0.044444
scylla paramamosain0.044444
mud crab0.044444
depth 10 cm0.044444
age 30-500.044444
age 60-790.044444
biofilter0.044444
river nile0.044444
depth 50cm0.044444
cairo0.044444
spring water0.044444
shrimp farm0.044444
pond water0.043956
free floating0.043956
LOWER IN fresh water0.043478
state of wisconsin0.043478
wet season0.043478
oncorhynchus mykiss0.042553
rainbow trout0.042553
mouse0.042105
age 4 weeks0.041667
sand0.041667
egypt0.041667
LOWER IN water0.041237
homo sapiens0.039578
mus musculus0.039216
LOWER IN caecum0.036364
dog0.036364
LOWER IN winter0.035088
canis lupus familiaris0.033898
female0.029557
adult0.028369
control0.026432
green turtle0.022727
chelonia mydas0.022727
gulf of mexico0.022727
neritic zone0.022727
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.500000
oreochromis niloticus0.666667
ictalurus punctatus0.666667
channel catfish0.666667
fishpond0.666667
snake0.666667
osteopilus septentrionalis0.666667
fish farm0.666667
frog0.571429
fresh water0.526316
texas0.500000
nile tilapia0.500000
catfish0.500000
freshwater sediment metagenome0.500000
tilapia0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
tadpole0.500000
state of alabama0.500000
green turtle0.500000
chelonia mydas0.500000
gulf of mexico0.500000
neritic zone0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
freshwater river biome0.500000
yangtze river0.500000
LOWER IN age 9 weeks0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
age 9 weeks0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
eriocheir sinensis0.500000
LOWER IN cadmium0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
anaxyrus terrestris0.500000
southern toad0.500000
coturnix coturnix0.500000
common quail0.500000
saline water aquarium0.500000
scylla paramamosain0.500000
mud crab0.500000
spring0.500000
eublepharis macularius0.500000
leopard gecko0.500000
LOWER IN rainbow trout0.500000
LOWER IN oncorhynchus mykiss0.500000
river0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age >940.500000
jiulong river0.500000
fujian province0.500000
biofilter0.500000
middle0.500000
bottom0.500000
bangladesh0.500000
astyanax paranae0.500000
astyanax0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
poecilia reticulata0.500000
guppy0.500000
populated place0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
turbidity0.500000
river nile0.500000
depth 50cm0.500000
cairo0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
spring water0.500000
location 10.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
mississippi river0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.465116
research facility0.348837
china0.348837
intestine0.220930
feces0.220930
fresh water0.197674
digestive system0.186047
water0.174419
fish0.127907
farm0.127907
hunan province0.127907
river0.127907
texas0.116279
colon0.104651
snake0.104651
oreochromis niloticus0.093023
pond0.093023
snake farm0.093023
adula0.093023
nile tilapia0.069767
danio rerio0.069767
zebra fish0.069767
frog0.069767
homo sapiens0.069767
ictalurus punctatus0.058140
channel catfish0.058140
england0.058140
adult0.046512
mus musculus0.046512
mouse0.046512
state of florida0.046512
state of alabama0.046512
autumn0.046512
brazil0.046512
fish farm0.046512
mississippi river0.046512
state of minnesota0.034884
sediment0.034884
fishpond0.034884
caecum0.034884
cyprinus carpio0.034884
common carp0.034884
jiangxi province0.034884
quasipaa spinosa0.034884
giant spiny frog0.034884
c57bl/60.034884
female0.034884
state of oregon0.034884
tadpole0.034884
control0.034884
saline water0.034884
depth 0.5m0.034884
jiulong river0.034884
fujian province0.034884
city0.034884
summer0.034884
aquatic biome0.034884
catfish0.023256
freshwater sediment metagenome0.023256
tilapia0.023256
elaphe carinata0.023256
king ratsnake0.023256
oncorhynchus mykiss0.023256
rainbow trout0.023256
naja atra0.023256
chinese cobra0.023256
ptyas mucosa0.023256
oriental ratsnake0.023256
age 4 weeks0.023256
osteopilus septentrionalis0.023256
deinagkistrodon acutus0.023256
pit viper0.023256
LOWER IN caecum0.023256
LOWER IN water0.023256
LOWER IN fresh water0.023256
canis lupus familiaris0.023256
dog0.023256
saline water aquarium0.023256
scylla paramamosain0.023256
mud crab0.023256
depth 10 cm0.023256
age 30-500.023256
age 60-790.023256
LOWER IN winter0.023256
pond water0.023256
biofilter0.023256
sand0.023256
state of wisconsin0.023256
river nile0.023256
depth 50cm0.023256
cairo0.023256
egypt0.023256
wet season0.023256
spring water0.023256
free floating0.023256
shrimp farm0.023256
early timepoints0.011628
LOWER IN fasting0.011628
LOWER IN late timepoints0.011628
green turtle0.011628
Exp. ID User ID Description Date Region Flag Sequences
108amnondecreases during fasting in nile tilapia colon ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 4
255amnondominant catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 5
108amnondominant research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 6
112amnondominant danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
257amnonhigh freq. in tilapia pond sediment (dominant sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 6
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
108amnondominant research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
396amnondominant fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 10
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
396amnondominant fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 12
315amnonhigh freq. in frog gut (dominant hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
471amnondominant digestive system, frog, osteopilus septentrionalis, research facility, united states of america, tadpole, state of florida2019-01-14v4No1 / 16
481amnondominant united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
288amnondominant green turtle, chelonia mydas, gulf of mexico, cloaca, neritic zone, autumn2018-01-29v4No1 / 18
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
396amnoncommon fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 21
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
530amnondominant snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 28
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
509amnon high in urinary schistosomiasis schistosomiasis compared to control in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 34
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
108amnon high in caecum compared to colon in research facility texas united states of america mus musculus mouse 2017-04-07v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
315amnonlower in frog pond water compared to frog gut ( high in quasipaa spinosa giant spiny frog frog compared to water fresh water in hunan province jiangxi province china )2018-04-10v4No1 / 119
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
315amnoncommon in frog gut (common hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 138
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
579amnoncommon in pond water of mud crab aquaculture (common china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab, spring)2020-01-14v3No1 / 173
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
107amnoncommon research facility, texas, united states of america, colon, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
254amnon high in autumn compared to winter summer in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 206
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
459amnoncommon in middle, bottom in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
579amnoncommon in pond water of mud crab aquaculture (common china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab, summer, autumn)2020-01-14v3No1 / 374
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, winter, dry season2018-08-31v4No1 / 403
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 518
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
257amnoncommon in tilapia pond sediment (common sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 1179
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org