Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGAAAAATAAGTCTGATGTTAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTTTTTCTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
intestine0.291987
fresh water0.263158
digestive system0.219608
river0.207547
fish0.203327
china0.192616
texas0.192308
hunan province0.188034
snake0.184615
pond0.179104
water0.171178
oreochromis niloticus0.166667
research facility0.160000
snake farm0.160000
adula0.160000
united states of america0.143905
colon0.127660
frog0.126984
nile tilapia0.125000
zebra fish0.121212
danio rerio0.117647
ictalurus punctatus0.109290
channel catfish0.109290
england0.106383
farm0.104513
fish farm0.088889
state of alabama0.086957
mississippi river0.086957
autumn0.083333
fishpond0.067797
cyprinus carpio0.066667
common carp0.066667
quasipaa spinosa0.066667
giant spiny frog0.066667
tadpole0.066667
jiulong river0.066667
fujian province0.066667
aquatic biome0.066667
feces0.065475
jiangxi province0.064516
depth 0.5m0.064516
saline water0.062500
state of minnesota0.060606
state of oregon0.060606
city0.059406
summer0.058824
brazil0.057143
sediment0.050633
c57bl/60.046512
osteopilus septentrionalis0.045977
catfish0.045455
freshwater sediment metagenome0.045455
tilapia0.045455
elaphe carinata0.045455
king ratsnake0.045455
naja atra0.045455
chinese cobra0.045455
ptyas mucosa0.045455
oriental ratsnake0.045455
deinagkistrodon acutus0.045455
pit viper0.045455
mud crab0.045455
scylla paramamosain0.045455
saline water aquarium0.045455
depth 10 cm0.045455
age 30-500.045455
age 60-790.045455
pond water0.045455
biofilter0.045455
river nile0.045455
depth 50cm0.045455
cairo0.045455
shrimp farm0.045455
free floating0.044944
LOWER IN fresh water0.044444
state of wisconsin0.044444
wet season0.044444
mouse0.043956
oncorhynchus mykiss0.043478
rainbow trout0.043478
age 4 weeks0.042553
sand0.042553
egypt0.042553
homo sapiens0.042194
LOWER IN water0.042105
state of florida0.041237
mus musculus0.040816
caecum0.040000
LOWER IN caecum0.038462
dog0.037037
LOWER IN winter0.035714
canis lupus familiaris0.034483
female0.032258
adult0.031746
control0.028169
green turtle0.023256
chelonia mydas0.023256
gulf of mexico0.023256
neritic zone0.023256
coreius guichenoti0.023256
Fraction of dbbact annotations with this term covered by the query
TermScore
pond1.500000
oreochromis niloticus0.666667
ictalurus punctatus0.666667
channel catfish0.666667
fishpond0.666667
snake0.666667
osteopilus septentrionalis0.666667
fish farm0.666667
frog0.571429
texas0.500000
nile tilapia0.500000
catfish0.500000
freshwater sediment metagenome0.500000
tilapia0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
snake farm0.500000
adula0.500000
elaphe carinata0.500000
king ratsnake0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
naja atra0.500000
chinese cobra0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
tadpole0.500000
state of alabama0.500000
green turtle0.500000
chelonia mydas0.500000
gulf of mexico0.500000
neritic zone0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
freshwater river biome0.500000
yangtze river0.500000
LOWER IN age 9 weeks0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
age 9 weeks0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
eriocheir sinensis0.500000
LOWER IN cadmium0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
anaxyrus terrestris0.500000
southern toad0.500000
coturnix coturnix0.500000
common quail0.500000
mud crab0.500000
scylla paramamosain0.500000
saline water aquarium0.500000
eublepharis macularius0.500000
leopard gecko0.500000
LOWER IN rainbow trout0.500000
LOWER IN oncorhynchus mykiss0.500000
river0.500000
fresh water0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age >940.500000
jiulong river0.500000
fujian province0.500000
pond water0.500000
biofilter0.500000
middle0.500000
bottom0.500000
bangladesh0.500000
astyanax paranae0.500000
astyanax0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
poecilia reticulata0.500000
guppy0.500000
populated place0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
turbidity0.500000
river nile0.500000
depth 50cm0.500000
cairo0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
mississippi river0.500000
depth 1m0.500000
lower mississippi river0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.452381
research facility0.357143
china0.357143
intestine0.226190
feces0.226190
digestive system0.190476
fresh water0.178571
water0.154762
fish0.130952
farm0.130952
hunan province0.130952
river0.130952
texas0.119048
colon0.107143
snake0.107143
oreochromis niloticus0.095238
pond0.095238
snake farm0.095238
adula0.095238
nile tilapia0.071429
danio rerio0.071429
zebra fish0.071429
frog0.071429
homo sapiens0.071429
ictalurus punctatus0.059524
channel catfish0.059524
england0.059524
adult0.047619
mus musculus0.047619
mouse0.047619
state of alabama0.047619
autumn0.047619
brazil0.047619
fish farm0.047619
mississippi river0.047619
state of minnesota0.035714
sediment0.035714
fishpond0.035714
caecum0.035714
cyprinus carpio0.035714
common carp0.035714
jiangxi province0.035714
quasipaa spinosa0.035714
giant spiny frog0.035714
c57bl/60.035714
female0.035714
state of oregon0.035714
tadpole0.035714
control0.035714
saline water0.035714
depth 0.5m0.035714
jiulong river0.035714
fujian province0.035714
city0.035714
summer0.035714
aquatic biome0.035714
catfish0.023810
freshwater sediment metagenome0.023810
tilapia0.023810
elaphe carinata0.023810
king ratsnake0.023810
oncorhynchus mykiss0.023810
rainbow trout0.023810
naja atra0.023810
chinese cobra0.023810
ptyas mucosa0.023810
oriental ratsnake0.023810
age 4 weeks0.023810
osteopilus septentrionalis0.023810
state of florida0.023810
deinagkistrodon acutus0.023810
pit viper0.023810
LOWER IN caecum0.023810
LOWER IN water0.023810
LOWER IN fresh water0.023810
canis lupus familiaris0.023810
dog0.023810
mud crab0.023810
scylla paramamosain0.023810
saline water aquarium0.023810
depth 10 cm0.023810
age 30-500.023810
age 60-790.023810
LOWER IN winter0.023810
pond water0.023810
biofilter0.023810
sand0.023810
state of wisconsin0.023810
river nile0.023810
depth 50cm0.023810
cairo0.023810
egypt0.023810
wet season0.023810
free floating0.023810
shrimp farm0.023810
early timepoints0.011905
LOWER IN fasting0.011905
LOWER IN late timepoints0.011905
green turtle0.011905
chelonia mydas0.011905
Exp. ID User ID Description Date Region Flag Sequences
108amnondecreases during fasting in nile tilapia colon ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 4
255amnonhighfreq catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 5
108amnonhighfreq research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 6
112amnonhighfreq danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
113amnonhighfreq danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
257amnonhigh freq. in tilapia pond sediment (highfreq sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 6
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
108amnonhighfreq research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
396amnonhighfreq fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 10
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
396amnonhighfreq fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 12
315amnonhigh freq. in frog gut (highfreq hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
530amnonhighfreq snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
471amnonhighfreq digestive system, frog, osteopilus septentrionalis, research facility, united states of america, tadpole, state of florida2019-01-14v4No1 / 16
481amnonhighfreq united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
288amnonhighfreq green turtle, chelonia mydas, gulf of mexico, cloaca, neritic zone, autumn2018-01-29v4No1 / 18
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
396amnoncommon fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 21
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
530amnonhighfreq snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 28
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
509amnon high in urinary schistosomiasis schistosomiasis compared to control in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 34
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
108amnon high in caecum compared to colon in research facility texas united states of america mus musculus mouse 2017-04-07v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
315amnonlower in frog pond water compared to frog gut ( high in quasipaa spinosa giant spiny frog frog compared to water fresh water in hunan province jiangxi province china )2018-04-10v4No1 / 119
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
315amnoncommon in frog gut (common hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 138
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
579amnoncommon in pond water of mud crab aquaculture (common spring, mud crab, scylla paramamosain, fish farm, saline water aquarium, saline water, pond, china)2020-01-14v3No1 / 173
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
107amnoncommon research facility, texas, united states of america, colon, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
254amnon high in autumn compared to winter summer in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 206
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
459amnoncommon in middle, bottom in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
579amnoncommon in pond water of mud crab aquaculture (common autumn, summer, mud crab, scylla paramamosain, fish farm, saline water aquarium, saline water, pond, china)2020-01-14v3No1 / 374
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 395
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, winter, dry season2018-08-31v4No1 / 403
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
366amnoncommon river nile, water, river, fresh water, depth 50cm, cairo, egypt, summer, wet season2018-08-31v4No1 / 474
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
257amnoncommon in tilapia pond sediment (common sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 1179
536amnon high in aquatic snake compared to terrestrial snake in snake skin united states of america southern united states 2019-07-28v4No1 / 1772
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3559

Problems / suggestions? Please email info AT dbbact DOT org