Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGAAAGATAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTCTTTCTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
snake farm0.400000
adula0.400000
naja atra0.400000
chinese cobra0.400000
mud crab0.400000
scylla paramamosain0.400000
saline water aquarium0.400000
pond0.400000
snake0.333333
fish farm0.333333
LOWER IN amerindian0.250000
LOWER IN hunter gatherer0.250000
LOWER IN venezuela0.250000
age >940.250000
LOWER IN age 30-500.250000
LOWER IN age 60-790.250000
hunan province0.222222
saline water0.181818
spring0.142857
autumn0.133333
city0.086957
summer0.083333
farm0.076923
china0.063425
feces0.028103
homo sapiens0.023121
united states of america0.010363
Fraction of dbbact annotations with this term covered by the query
TermScore
snake farm0.500000
adula0.500000
naja atra0.500000
chinese cobra0.500000
mud crab0.500000
scylla paramamosain0.500000
saline water aquarium0.500000
pond0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
snake0.333333
fish farm0.333333
hunan province0.166667
spring0.125000
saline water0.125000
autumn0.111111
city0.058824
summer0.055556
farm0.043478
china0.032967
feces0.014354
homo sapiens0.011976
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
china0.833333
feces0.666667
snake0.333333
snake farm0.333333
farm0.333333
adula0.333333
hunan province0.333333
naja atra0.333333
chinese cobra0.333333
mud crab0.333333
scylla paramamosain0.333333
fish farm0.333333
saline water aquarium0.333333
saline water0.333333
pond0.333333
homo sapiens0.333333
spring0.166667
autumn0.166667
summer0.166667
united states of america0.166667
city0.166667
LOWER IN amerindian0.166667
LOWER IN hunter gatherer0.166667
LOWER IN venezuela0.166667
age >940.166667
LOWER IN age 30-500.166667
LOWER IN age 60-790.166667

Problems / suggestions? Please email info AT dbbact DOT org