Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCTTAGTAAGTCTGATGTGAAAATGCGGGGCTCAACCCCGTATTGCGTTGGAAACTGCTAAACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
snake0.228571
adult organism0.227027
anaxyrus terrestris0.121212
southern toad0.121212
field cricket0.121212
antibiotics induced colitis0.121212
age 90 weeks0.121212
southern united states0.121212
coluber constrictor0.121212
eastern racer snake0.121212
adriatic sea coastal waters of italy0.121212
caretta caretta0.121212
loggerhead sea turtle0.121212
opatija0.121212
anisakis pegreffii0.121212
dolphin parasite0.121212
rana pipiens0.121212
northern leopard frog0.121212
adula0.121212
snake farm0.121212
nanning city prefecture0.121212
sixth decade human stage0.121212
colon0.115607
gryllinae0.114286
croatia0.114286
state of texas0.113208
state of wisconsin0.108108
midgut0.102564
mediterranean sea0.097561
equus caballus0.096774
horse0.096774
digesta0.093023
hunan province0.093023
intestine0.088235
skin0.075000
digestive system0.069767
bufo marinus0.066667
municipality of bayamon0.066667
cane toad0.066667
colitis0.066116
ptyas mucosa0.064516
oriental ratsnake0.064516
naja atra0.064516
chinese cobra0.064516
LOWER IN cyprinus carpio0.064516
LOWER IN common carp0.064516
LOWER IN plant diet0.064516
quail0.064516
coturnix coturnix0.064516
taipei city0.064516
low anterior resection0.064516
nephrolithiasis0.064516
LOWER IN age 0-6 months0.064516
indonesia0.064516
municipality of yogyakarta0.064516
skin epidermis0.062500
animal product diet0.062500
salmonella gastroenteritis0.062500
mouth neoplasm0.062500
antibiotic0.061538
chicken0.061538
puerto rico0.060606
oncorhynchus mykiss0.060606
rainbow trout0.060606
taiwan0.060606
salmonellosis0.060606
gallus gallus0.059701
LOWER IN tadpole0.057143
italy0.054795
belgium0.054054
cloaca0.052632
cancer0.052632
england0.051282
vagina0.050000
adult0.048990
australia0.048193
2-5 year-old child stage0.047619
LOWER IN larval stage0.046512
crohn's disease0.046512
research facility0.045743
fish0.045455
feces0.044096
china0.039688
farm0.038835
homo sapiens0.038234
united states of america0.036740
LOWER IN infant0.033898
diet0.032258
child0.029412
LOWER IN control0.028335
LOWER IN caecum0.028169
saliva0.026316
control0.009132
Fraction of dbbact annotations with this term covered by the query
TermScore
bufo marinus1.000000
municipality of bayamon1.000000
cane toad1.000000
snake0.666667
anaxyrus terrestris0.500000
southern toad0.500000
field cricket0.500000
antibiotics induced colitis0.500000
age 90 weeks0.500000
southern united states0.500000
coluber constrictor0.500000
eastern racer snake0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
opatija0.500000
anisakis pegreffii0.500000
dolphin parasite0.500000
rana pipiens0.500000
northern leopard frog0.500000
adula0.500000
snake farm0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
LOWER IN plant diet0.500000
quail0.500000
coturnix coturnix0.500000
taipei city0.500000
low anterior resection0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sixth decade human stage0.500000
LOWER IN age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
skin epidermis0.333333
gryllinae0.333333
croatia0.333333
animal product diet0.333333
salmonella gastroenteritis0.333333
mouth neoplasm0.333333
puerto rico0.250000
state of wisconsin0.250000
oncorhynchus mykiss0.250000
rainbow trout0.250000
taiwan0.250000
salmonellosis0.250000
adult organism0.214286
midgut0.200000
mediterranean sea0.166667
LOWER IN tadpole0.166667
digesta0.142857
hunan province0.142857
state of texas0.125000
belgium0.125000
cloaca0.111111
cancer0.111111
england0.100000
equus caballus0.090909
horse0.090909
vagina0.090909
colon0.086957
intestine0.076923
2-5 year-old child stage0.076923
LOWER IN larval stage0.071429
crohn's disease0.071429
fish0.066667
skin0.058824
antibiotic0.055556
chicken0.055556
digestive system0.052632
gallus gallus0.052632
italy0.045455
colitis0.043478
australia0.037037
LOWER IN infant0.033333
diet0.030303
farm0.027027
adult0.026882
child0.025641
research facility0.024691
LOWER IN caecum0.023810
feces0.023188
china0.021622
saliva0.021277
homo sapiens0.020761
united states of america0.019305
LOWER IN control0.015789
control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
feces0.448276
united states of america0.379310
research facility0.310345
adult0.275862
adult organism0.241379
china0.241379
homo sapiens0.241379
colon0.172414
colitis0.137931
snake0.137931
LOWER IN control0.137931
skin0.103448
state of texas0.103448
digestive system0.103448
equus caballus0.103448
horse0.103448
intestine0.103448
anaxyrus terrestris0.068966
southern toad0.068966
midgut0.068966
australia0.068966
gryllinae0.068966
field cricket0.068966
antibiotic0.068966
antibiotics induced colitis0.068966
gallus gallus0.068966
chicken0.068966
age 90 weeks0.068966
southern united states0.068966
coluber constrictor0.068966
eastern racer snake0.068966
mediterranean sea0.068966
italy0.068966
adriatic sea coastal waters of italy0.068966
caretta caretta0.068966
loggerhead sea turtle0.068966
croatia0.068966
opatija0.068966
anisakis pegreffii0.068966
dolphin parasite0.068966
state of wisconsin0.068966
digesta0.068966
rana pipiens0.068966
northern leopard frog0.068966
farm0.068966
hunan province0.068966
adula0.068966
snake farm0.068966
nanning city prefecture0.068966
sixth decade human stage0.068966
puerto rico0.034483
skin epidermis0.034483
bufo marinus0.034483
municipality of bayamon0.034483
cane toad0.034483
cloaca0.034483
LOWER IN larval stage0.034483
vagina0.034483
LOWER IN tadpole0.034483
crohn's disease0.034483
belgium0.034483
ptyas mucosa0.034483
oriental ratsnake0.034483
naja atra0.034483
chinese cobra0.034483
oncorhynchus mykiss0.034483
rainbow trout0.034483
LOWER IN cyprinus carpio0.034483
LOWER IN common carp0.034483
england0.034483
fish0.034483
diet0.034483
animal product diet0.034483
LOWER IN plant diet0.034483
LOWER IN caecum0.034483
quail0.034483
coturnix coturnix0.034483
taipei city0.034483
taiwan0.034483
low anterior resection0.034483
salmonella gastroenteritis0.034483
salmonellosis0.034483
nephrolithiasis0.034483
control0.034483
2-5 year-old child stage0.034483
LOWER IN infant0.034483
LOWER IN age 0-6 months0.034483
child0.034483
indonesia0.034483
municipality of yogyakarta0.034483
mouth neoplasm0.034483
cancer0.034483
saliva0.034483
Exp. ID User ID Description Date Region Flag Sequences
921amnondominant skin, puerto rico, skin epidermis, bufo marinus, municipality of bayamon, cane toad2022-07-24v4No1 / 10
108amnondominant united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
324amnondominant digestive system, midgut, colon, australia, gryllinae, field cricket2018-04-27v4No1 / 16
902amnondominant feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 16
795amnondominant research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 18
536amnondominant united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
670amnon high in adult adult organism compared to larval stage in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 22
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
670amnoncommon adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 24
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
324amnoncommon digestive system, midgut, colon, australia, gryllinae, field cricket2018-04-27v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 226
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364

Problems / suggestions? Please email info AT dbbact DOT org