Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCTTAGTAAGTCTGATGTGAAAATGCGGGGCTCAACCCCGTATTGCGTTGGAAACTGCTAAACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
china0.491228
colon0.307692
snake0.258065
adult organism0.195122
adula0.148148
anaxyrus terrestris0.137931
southern toad0.137931
field cricket0.137931
age 90 weeks0.137931
southern united states0.137931
coluber constrictor0.137931
eastern racer snake0.137931
adriatic sea coastal waters of italy0.137931
caretta caretta0.137931
loggerhead sea turtle0.137931
opatija0.137931
anisakis pegreffii0.137931
dolphin parasite0.137931
rana pipiens0.137931
northern leopard frog0.137931
snake farm0.137931
nanning city prefecture0.137931
sixth decade human stage0.137931
gryllinae0.129032
croatia0.129032
state of texas0.122449
state of wisconsin0.121212
midgut0.114286
mediterranean sea0.108108
digesta0.102564
hunan province0.102564
intestine0.096000
ptyas mucosa0.074074
oriental ratsnake0.074074
naja atra0.074074
chinese cobra0.074074
LOWER IN cyprinus carpio0.074074
LOWER IN common carp0.074074
LOWER IN plant diet0.074074
quail0.074074
coturnix coturnix0.074074
taipei city0.074074
low anterior resection0.074074
nephrolithiasis0.074074
LOWER IN age 0-6 months0.074074
indonesia0.074074
municipality of yogyakarta0.074074
digestive system0.073171
animal product diet0.071429
mouth neoplasm0.071429
chicken0.070175
oncorhynchus mykiss0.068966
rainbow trout0.068966
taiwan0.068966
gallus gallus0.067797
LOWER IN tadpole0.064516
cancer0.062500
italy0.061538
belgium0.060606
cloaca0.058824
england0.058824
australia0.056338
vagina0.055556
2-5 year-old child stage0.055556
crohn's disease0.054054
adult0.053015
LOWER IN larval stage0.051282
research facility0.050597
fish0.050000
skin0.043956
feces0.042232
farm0.041237
homo sapiens0.041036
LOWER IN infant0.039216
diet0.034483
LOWER IN caecum0.032787
child0.032787
united states of america0.030829
saliva0.028169
LOWER IN control0.019048
control0.009524
Fraction of dbbact annotations with this term covered by the query
TermScore
china2.000000
adula1.000000
colon0.666667
snake0.666667
anaxyrus terrestris0.500000
southern toad0.500000
field cricket0.500000
age 90 weeks0.500000
southern united states0.500000
coluber constrictor0.500000
eastern racer snake0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
opatija0.500000
anisakis pegreffii0.500000
dolphin parasite0.500000
rana pipiens0.500000
northern leopard frog0.500000
snake farm0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
naja atra0.500000
chinese cobra0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
LOWER IN plant diet0.500000
quail0.500000
coturnix coturnix0.500000
taipei city0.500000
low anterior resection0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sixth decade human stage0.500000
LOWER IN age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
gryllinae0.333333
croatia0.333333
animal product diet0.333333
mouth neoplasm0.333333
adult organism0.250000
state of wisconsin0.250000
oncorhynchus mykiss0.250000
rainbow trout0.250000
taiwan0.250000
midgut0.200000
mediterranean sea0.166667
LOWER IN tadpole0.166667
digesta0.142857
hunan province0.142857
cancer0.142857
state of texas0.125000
belgium0.125000
cloaca0.111111
england0.111111
vagina0.090909
2-5 year-old child stage0.090909
crohn's disease0.083333
intestine0.080000
LOWER IN larval stage0.071429
fish0.066667
chicken0.062500
gallus gallus0.058824
digestive system0.052632
italy0.050000
australia0.043478
LOWER IN infant0.038462
skin0.030303
diet0.030303
adult0.028902
farm0.027778
LOWER IN caecum0.027778
child0.027778
research facility0.027211
feces0.022293
homo sapiens0.022140
saliva0.021739
united states of america0.016194
LOWER IN control0.010811
control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces0.400000
research facility0.360000
united states of america0.320000
adult0.320000
china0.280000
homo sapiens0.280000
colon0.200000
adult organism0.160000
snake0.160000
state of texas0.120000
digestive system0.120000
intestine0.120000
anaxyrus terrestris0.080000
southern toad0.080000
midgut0.080000
australia0.080000
gryllinae0.080000
field cricket0.080000
gallus gallus0.080000
chicken0.080000
age 90 weeks0.080000
skin0.080000
southern united states0.080000
coluber constrictor0.080000
eastern racer snake0.080000
mediterranean sea0.080000
italy0.080000
adriatic sea coastal waters of italy0.080000
caretta caretta0.080000
loggerhead sea turtle0.080000
croatia0.080000
opatija0.080000
anisakis pegreffii0.080000
dolphin parasite0.080000
state of wisconsin0.080000
digesta0.080000
rana pipiens0.080000
northern leopard frog0.080000
LOWER IN control0.080000
farm0.080000
hunan province0.080000
adula0.080000
snake farm0.080000
nanning city prefecture0.080000
sixth decade human stage0.080000
cloaca0.040000
LOWER IN larval stage0.040000
vagina0.040000
LOWER IN tadpole0.040000
crohn's disease0.040000
belgium0.040000
ptyas mucosa0.040000
oriental ratsnake0.040000
naja atra0.040000
chinese cobra0.040000
oncorhynchus mykiss0.040000
rainbow trout0.040000
LOWER IN cyprinus carpio0.040000
LOWER IN common carp0.040000
england0.040000
fish0.040000
diet0.040000
animal product diet0.040000
LOWER IN plant diet0.040000
LOWER IN caecum0.040000
quail0.040000
coturnix coturnix0.040000
taipei city0.040000
taiwan0.040000
low anterior resection0.040000
nephrolithiasis0.040000
control0.040000
2-5 year-old child stage0.040000
LOWER IN infant0.040000
LOWER IN age 0-6 months0.040000
child0.040000
indonesia0.040000
municipality of yogyakarta0.040000
mouth neoplasm0.040000
cancer0.040000
saliva0.040000
Exp. ID User ID Description Date Region Flag Sequences
108amnondominant united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
324amnondominant digestive system, midgut, colon, australia, gryllinae, field cricket2018-04-27v4No1 / 16
795amnondominant research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 18
536amnondominant united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
670amnon high in adult adult organism compared to larval stage in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 22
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
670amnoncommon adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 24
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
324amnoncommon digestive system, midgut, colon, australia, gryllinae, field cricket2018-04-27v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319

Problems / suggestions? Please email info AT dbbact DOT org