Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAAACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
china0.593592
guangzhou city prefecture0.131148
kingdom of spain0.129032
homo sapiens0.123823
rural community0.109589
feces0.109005
air0.106667
himalayas0.105263
nanning city prefecture0.105263
sixth decade human stage0.105263
free range chicken0.105263
size < 10um0.105263
nepal0.100000
dust0.100000
adult0.096618
chicken0.096386
gallus gallus0.094118
israel0.094118
caecum0.090090
bird0.085106
state of california0.077670
beach0.075472
isla de salvora0.072727
age 8 days0.072727
larus michahellis0.072727
gull0.072727
nephrolithiasis0.072727
age 12 weeks0.072727
mallard0.072727
gay0.072727
clear day0.072727
skin0.071429
LOWER IN heterosexual0.071429
LOWER IN msw0.071429
homosexual0.070175
msm0.070175
65-79 year-old human stage0.070175
ulcerative colitis0.067797
anas platyrhynchos0.067797
fifth decade human stage0.067797
state of colorado0.066667
farm0.065041
crohn's disease0.063492
fourth decade human stage0.061538
cloaca0.057971
child0.057143
water0.056604
united states of america0.054732
canis lupus familiaris0.051948
research facility0.040404
pacific ocean0.039604
acute pancreatitis0.038462
pancreatitis0.038462
age 90 weeks0.037736
tharu0.037736
agrarian0.037736
LOWER IN chepang0.037736
age 2 days0.037736
puppy0.037736
nicotiana galuca0.037736
swan goose0.037736
age 6 months0.037736
LOWER IN age 8 months0.037736
rhesus macaque0.037736
raji0.037736
denver0.037736
LOWER IN influenza0.037736
dermanyssus gallinae0.037736
red poulty mite0.037736
poulty farm0.037736
diarrhea0.037736
bangladesh0.037736
LOWER IN dust day0.037736
LOWER IN age &gt;940.037736
LOWER IN tenth decade human stage0.037736
antananarivo0.037736
LOWER IN bangui0.037736
quail0.037736
coturnix coturnix0.037736
LOWER IN age 3-60.037736
LOWER IN age 8-120.037736
new delhi0.037736
LOWER IN sand0.037736
aerosol0.037736
san francisco bay0.037736
salinity <5 ppt0.037736
LOWER IN salinity &gt;20 ppt0.037736
estuary water0.037736
bilbao0.037736
dust storm0.037736
nanchang city prefecture0.037037
LOWER IN forager0.037037
nectar0.037037
anser cygnoides0.037037
delphinus delphis0.037037
estonia0.037037
age < 3 years0.037037
LOWER IN ninth decade human stage0.037037
madagascar0.037037
LOWER IN central african republic0.037037
Fraction of dbbact annotations with this term covered by the query
TermScore
china5.500000
acute pancreatitis1.000000
pancreatitis1.000000
beach1.000000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
age 90 weeks0.500000
tharu0.500000
agrarian0.500000
LOWER IN chepang0.500000
himalayas0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
sixth decade human stage0.500000
age 2 days0.500000
puppy0.500000
free range chicken0.500000
age 12 weeks0.500000
mallard0.500000
nicotiana galuca0.500000
swan goose0.500000
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
raji0.500000
gay0.500000
denver0.500000
LOWER IN influenza0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
diarrhea0.500000
bangladesh0.500000
clear day0.500000
LOWER IN dust day0.500000
size < 10um0.500000
LOWER IN age &gt;940.500000
LOWER IN tenth decade human stage0.500000
antananarivo0.500000
LOWER IN bangui0.500000
quail0.500000
coturnix coturnix0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
new delhi0.500000
LOWER IN sand0.500000
aerosol0.500000
san francisco bay0.500000
salinity <5 ppt0.500000
LOWER IN salinity &gt;20 ppt0.500000
estuary water0.500000
bilbao0.500000
dust storm0.500000
guangzhou city prefecture0.400000
LOWER IN heterosexual0.400000
LOWER IN msw0.400000
nanchang city prefecture0.333333
LOWER IN forager0.333333
nepal0.333333
nectar0.333333
anser cygnoides0.333333
delphinus delphis0.333333
homosexual0.333333
msm0.333333
estonia0.333333
age < 3 years0.333333
dust0.333333
65-79 year-old human stage0.333333
LOWER IN ninth decade human stage0.333333
madagascar0.333333
LOWER IN central african republic0.333333
mouth neoplasm0.333333
LOWER IN colon0.333333
tibet autonomous region0.333333
ulcerative colitis0.250000
anas platyrhynchos0.250000
biopsy site0.250000
age 8 weeks0.250000
fifth decade human stage0.250000
inguinal region0.250000
estuary0.250000
state of colorado0.222222
rectal swab0.200000
flower0.200000
shelled egg0.200000
LOWER IN 6-12 year-old child stage0.200000
rural community0.181818
crohn's disease0.166667
macaca mulatta0.166667
air0.166667
thailand0.166667
cecal content0.166667
small intestine0.166667
bird0.153846
kingdom of spain0.142857
3-month-old human stage0.142857
fourth decade human stage0.142857
cancer0.142857
Fraction of annotations for the query sequences containing the term
TermScore
feces0.549020
homo sapiens0.529412
china0.313725
adult0.294118
united states of america0.176471
kingdom of spain0.117647
caecum0.098039
research facility0.078431
gallus gallus0.078431
chicken0.078431
rural community0.078431
guangzhou city prefecture0.078431
control0.078431
farm0.078431
state of california0.078431
israel0.078431
air0.078431
bird0.058824
nepal0.058824
himalayas0.058824
nanning city prefecture0.058824
sixth decade human stage0.058824
free range chicken0.058824
LOWER IN control0.058824
skin0.058824
child0.058824
dust0.058824
size < 10um0.058824
water0.058824
isla de salvora0.039216
age 8 days0.039216
larus michahellis0.039216
gull0.039216
nephrolithiasis0.039216
canis lupus familiaris0.039216
crohn's disease0.039216
ulcerative colitis0.039216
age 12 weeks0.039216
cloaca0.039216
anas platyrhynchos0.039216
mallard0.039216
LOWER IN united states of america0.039216
LOWER IN feces0.039216
gay0.039216
homosexual0.039216
msm0.039216
LOWER IN heterosexual0.039216
LOWER IN msw0.039216
state of colorado0.039216
clear day0.039216
65-79 year-old human stage0.039216
fourth decade human stage0.039216
fifth decade human stage0.039216
africa0.039216
beach0.039216
pacific ocean0.039216
vagina0.019608
adult organism0.019608
age 90 weeks0.019608
nanchang city prefecture0.019608
acute pancreatitis0.019608
pancreatitis0.019608
tharu0.019608
agrarian0.019608
LOWER IN forager0.019608
LOWER IN chepang0.019608
french republic0.019608
dog0.019608
rectal swab0.019608
age 2 days0.019608
puppy0.019608
male0.019608
LOWER IN female0.019608
south korea0.019608
nectar0.019608
nicotiana galuca0.019608
flower0.019608
belgium0.019608
anser cygnoides0.019608
winter0.019608
swan goose0.019608
age 6 months0.019608
3-month-old human stage0.019608
LOWER IN age 8 months0.019608
macaca mulatta0.019608
monkey0.019608
captive0.019608
rhesus macaque0.019608
raji0.019608
delphinus delphis0.019608
rectum0.019608
biopsy site0.019608
biopsy0.019608
city0.019608
denver0.019608
LOWER IN influenza0.019608
female0.019608
LOWER IN male0.019608
larval stage0.019608
czech republic0.019608
Exp. ID User ID Description Date Region Flag Sequences
381amnoncommon feces, kingdom of spain, isla de salvora, bird, age 8 days, larus michahellis, gull2018-10-22v4No1 / 12
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
381amnondominant feces, kingdom of spain, isla de salvora, bird, age 8 days, larus michahellis, gull2018-10-22v4No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to forager chepang in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 19
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 27
81amnoncommon cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 30
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 214
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
108amnon high in caecum compared to colon in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 380
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
304amnonhigher in seawater compared to beach sand ( high in water sea water compared to sand in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 547
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 558
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902

Problems / suggestions? Please email info AT dbbact DOT org