Search result for sequence:
TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTCAAACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT
common ontology terms
term enrichment score
TermScore
china0.563758
city of melbourne0.301887
dog0.291971
canis lupus familiaris0.268456
foxhound0.262295
captive0.222222
gymnogyps californianus0.181818
california condor0.181818
state of idaho0.166667
bird0.154696
meat diet0.150943
zoological garden0.142857
rectal swab0.142857
high protein diet0.140351
age 2 days0.117647
puppy0.117647
dog breeding center0.117647
crohn's disease0.095238
italy0.094118
french republic0.090909
state of minnesota0.086957
adula0.085106
feces0.084913
pygoscelis papua0.081633
gentoo penguin0.081633
panthera tigris0.081633
tiger0.081633
snake farm0.081633
ptyas mucosa0.081633
oriental ratsnake0.081633
pygoscelis antarcticus0.081633
chinstrap penguin0.081633
age 2-7 years0.081633
domestic0.081633
wolf0.081633
vulpes vulpes0.081633
lake hulun0.081633
red fox0.081633
hydrolized diet0.081633
LOWER IN wolf0.081633
dalian city prefecture0.078431
snake0.078431
65-79 year-old human stage0.078431
LOWER IN age 8 weeks0.075472
fifth decade human stage0.075472
farm0.074074
wild0.074074
guangzhou city prefecture0.072727
mongolia0.072727
high fiber0.070175
australia0.069869
hunan province0.067797
fourth decade human stage0.067797
adult organism0.065574
cloaca0.063492
female organism0.056338
canis lupus0.056338
LOWER IN canis lupus0.056338
winter0.050633
balaenoptera acutorostrata0.042553
minke whale0.042553
harbor seal0.042553
phoca vitulina0.042553
LOWER IN puppy0.042553
LOWER IN hydrolized diet0.042553
LOWER IN wildlife sactuary0.042553
LOWER IN age 3-60.042553
LOWER IN age 8-120.042553
age >940.042553
tenth decade human stage0.042553
LOWER IN soldiers0.042553
colon0.041667
ninth decade human stage0.041667
LOWER IN 6-12 year-old child stage0.040000
LOWER IN young adult stage0.040000
LOWER IN high fiber0.039216
state of texas0.037736
belgium0.037736
LOWER IN cloaca0.037037
skin0.036036
LOWER IN 2-5 year-old child stage0.035714
LOWER IN zoological garden0.033333
LOWER IN captive0.031746
adult0.031204
research facility0.025478
LOWER IN caecum0.024691
LOWER IN child0.024691
united states of america0.022263
homo sapiens0.020134
mouse0.019608
mus musculus0.018519
LOWER IN control0.017391
control0.008696
Fraction of dbbact annotations with this term covered by the query
TermScore
china3.000000
adula1.000000
city of melbourne1.000000
gymnogyps californianus0.500000
california condor0.500000
pygoscelis papua0.500000
gentoo penguin0.500000
age 2 days0.500000
puppy0.500000
panthera tigris0.500000
tiger0.500000
snake farm0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
age 2-7 years0.500000
domestic0.500000
wolf0.500000
balaenoptera acutorostrata0.500000
minke whale0.500000
dog breeding center0.500000
vulpes vulpes0.500000
lake hulun0.500000
red fox0.500000
foxhound0.500000
meat diet0.500000
hydrolized diet0.500000
harbor seal0.500000
phoca vitulina0.500000
LOWER IN puppy0.500000
LOWER IN hydrolized diet0.500000
LOWER IN wolf0.500000
LOWER IN wildlife sactuary0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
state of idaho0.333333
dalian city prefecture0.333333
colon0.333333
snake0.333333
high protein diet0.333333
65-79 year-old human stage0.333333
ninth decade human stage0.333333
LOWER IN age 8 weeks0.250000
fifth decade human stage0.250000
captive0.222222
dog0.217391
zoological garden0.200000
rectal swab0.200000
guangzhou city prefecture0.200000
mongolia0.200000
LOWER IN 6-12 year-old child stage0.200000
LOWER IN young adult stage0.200000
canis lupus familiaris0.192308
crohn's disease0.166667
high fiber0.166667
LOWER IN high fiber0.166667
bird0.153846
hunan province0.142857
fourth decade human stage0.142857
state of texas0.125000
adult organism0.125000
state of minnesota0.125000
belgium0.125000
LOWER IN cloaca0.111111
cloaca0.111111
italy0.100000
LOWER IN 2-5 year-old child stage0.090909
wild0.083333
french republic0.076923
female organism0.076923
canis lupus0.076923
LOWER IN canis lupus0.076923
LOWER IN zoological garden0.066667
winter0.058824
farm0.055556
LOWER IN captive0.055556
feces0.044586
australia0.043478
skin0.030303
LOWER IN caecum0.027778
LOWER IN child0.027778
mouse0.017544
adult0.017341
mus musculus0.015873
research facility0.013605
united states of america0.012146
homo sapiens0.011070
LOWER IN control0.010811
control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces0.888889
canis lupus familiaris0.444444
dog0.444444
china0.311111
captive0.222222
research facility0.200000
australia0.177778
city of melbourne0.177778
foxhound0.177778
bird0.155556
adult0.155556
united states of america0.133333
state of idaho0.111111
gymnogyps californianus0.111111
california condor0.111111
zoological garden0.111111
french republic0.111111
rectal swab0.111111
farm0.111111
homo sapiens0.111111
italy0.088889
high protein diet0.088889
meat diet0.088889
age 2 days0.066667
puppy0.066667
crohn's disease0.066667
state of minnesota0.066667
wild0.066667
dog breeding center0.066667
dalian city prefecture0.044444
pygoscelis papua0.044444
gentoo penguin0.044444
panthera tigris0.044444
tiger0.044444
hunan province0.044444
adula0.044444
snake0.044444
snake farm0.044444
ptyas mucosa0.044444
oriental ratsnake0.044444
pygoscelis antarcticus0.044444
chinstrap penguin0.044444
LOWER IN control0.044444
guangzhou city prefecture0.044444
cloaca0.044444
female organism0.044444
adult organism0.044444
age 2-7 years0.044444
domestic0.044444
canis lupus0.044444
wolf0.044444
skin0.044444
mongolia0.044444
winter0.044444
vulpes vulpes0.044444
lake hulun0.044444
red fox0.044444
hydrolized diet0.044444
high fiber0.044444
LOWER IN age 8 weeks0.044444
LOWER IN canis lupus0.044444
LOWER IN wolf0.044444
65-79 year-old human stage0.044444
fourth decade human stage0.044444
fifth decade human stage0.044444
LOWER IN cloaca0.022222
colon0.022222
LOWER IN caecum0.022222
mus musculus0.022222
state of texas0.022222
mouse0.022222
balaenoptera acutorostrata0.022222
minke whale0.022222
control0.022222
harbor seal0.022222
phoca vitulina0.022222
belgium0.022222
LOWER IN puppy0.022222
LOWER IN hydrolized diet0.022222
LOWER IN high fiber0.022222
LOWER IN zoological garden0.022222
LOWER IN captive0.022222
LOWER IN wildlife sactuary0.022222
LOWER IN child0.022222
LOWER IN age 3-60.022222
LOWER IN age 8-120.022222
LOWER IN 2-5 year-old child stage0.022222
LOWER IN 6-12 year-old child stage0.022222
age >940.022222
ninth decade human stage0.022222
tenth decade human stage0.022222
LOWER IN soldiers0.022222
LOWER IN young adult stage0.022222
Exp. ID User ID Description Date Region Flag Sequences
645amnon high in feces compared to cloaca in state of idaho bird captive gymnogyps californianus california condor 2020-09-03v4No1 / 9
742amnondominant feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 9
645amnondominant feces, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 12
766amnoncommon feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 12
108amnon high in colon compared to caecum in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 13
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
530amnondominant feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
812amnondominant feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 14
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
645amnondominant cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 16
766amnondominant n in feces of dog females within 24h after parturition (dominant feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
666amnondominant feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 22
79amnoncommon united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
815amnondominant feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 24
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 29
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
645amnoncommon feces, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 49
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
742amnoncommon feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 70
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
822amnon high in high protein diet meat diet compared to hydrolized diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 103
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
822amnon high in high protein diet meat diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 123
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org