Search result for sequence:
TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGTCTGAAGTGAAAGCCCTCAGCTCAACTGAGGAATTGCTTTGGAAACTGGATGACTTGAGTGCAGTAGAGGAAAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
homo sapiens0.191217
rainbow trout0.180451
oncorhynchus mykiss0.180451
feces0.178119
fish0.174636
digestive system0.169323
sweden0.162791
child0.143791
skin0.132743
india0.130081
food (fermented)0.128000
hunter gatherer0.118310
rural community0.111702
united states of america0.106343
venezuela0.101695
amerindian0.101695
state of rhode island0.099174
research facility0.098673
pair of nares0.096774
obsolete_juvenile stage0.093023
infant0.088235
canada0.087719
arm0.085837
cold environment0.084034
costa rica0.080645
monkey0.077519
farm0.077419
gut content0.068376
12c0.068376
larvae insect diet0.068376
chuquisaca department0.068376
age 5-13 years0.066116
bos taurus0.064690
bolivia0.064000
horse0.064000
israel0.062016
equus caballus0.062016
sus scrofa0.055172
pig0.055172
united kingdom0.055172
china0.054983
fish feed0.052863
coffea arabica0.052174
wet season0.052174
LOWER IN dry season0.052174
forearm0.052174
barn0.052174
hay0.052174
age 30-500.052174
age 60-790.052174
LOWER IN mouth0.050209
ecuador0.049587
zoological garden0.049587
LOWER IN united states of america0.049587
wild0.047244
age0.046875
city0.044610
nasal cavity0.044118
adult0.041451
mouse0.037975
mus musculus0.036364
kimchi0.035398
zea mays subsp. mays0.035398
corn0.035398
food processing factory0.035398
wet processing0.035398
gastrointestinal system mucosa0.035398
red pepper sauce0.035398
LOWER IN warm temperature habitat0.035398
new delhi0.035398
sudan0.035398
LOWER IN pre pupae insect diet0.035398
zambia0.035398
ensete ventricosum0.035398
ethiopian banana0.035398
aerobic fermentation0.035398
days 1-150.035398
cyprinus carpio0.035398
common carp0.035398
england0.035398
holstein-friesian bull0.035398
kebbi state0.035398
age 10-15 years0.035398
LOWER IN pasture0.035398
age 130.035398
size < 10um0.035398
clear day0.035398
LOWER IN finland0.035398
decaying0.035398
jiulong river0.035398
fujian province0.035398
foodon product type0.035088
whole plant0.034783
floor0.034783
butterfly0.034783
capsicum annuum0.034783
cebus capucinus0.034783
white-faced capuchin0.034783
nigeria0.034783
south america0.034783
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
hunter gatherer0.750000
arm0.666667
venezuela0.666667
amerindian0.666667
fish feed0.666667
india0.571429
state of rhode island0.500000
kimchi0.500000
days 1-90.500000
food (fermented)0.500000
zea mays subsp. mays0.500000
corn0.500000
rainbow trout0.500000
oncorhynchus mykiss0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
food processing factory0.500000
12c0.500000
cold environment0.500000
coffea arabica0.500000
wet processing0.500000
waist circumference0.500000
large waist circumference0.500000
LOWER IN small waist circumference0.500000
exocrine pancreatic insufficiency0.500000
gastrointestinal system mucosa0.500000
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
red pepper sauce0.500000
low salt concentration0.500000
LOWER IN high salt concentration0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
hamelia patens0.500000
firebush0.500000
new delhi0.500000
miso food product0.500000
sudan0.500000
larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN low human contact0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
spices0.500000
spice or herb0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
LOWER IN defatted larvae insect diet0.500000
defatted larvae insect diet0.500000
bangladesh0.500000
LOWER IN intestinal contents0.500000
przewalski horse0.500000
LOWER IN fishmeal diet0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
defatted larvae insects diet0.500000
red pepper0.500000
wet season0.500000
LOWER IN dry season0.500000
holstein-friesian bull0.500000
605 days0.500000
LOWER IN 660 days0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
chuquisaca department0.500000
forearm0.500000
dry processing0.500000
LOWER IN age one month0.500000
barn0.500000
hay0.500000
skh-1 hairless mouse0.500000
dorsum0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
low income0.500000
sewer0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
LOWER IN pasture0.500000
age 130.500000
size < 10um0.500000
clear day0.500000
LOWER IN dust day0.500000
LOWER IN rainbow trout0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.348624
feces0.348624
united states of america0.183486
research facility0.155963
digestive system0.155963
sweden0.128440
fish0.128440
rainbow trout0.110092
oncorhynchus mykiss0.110092
child0.100917
skin0.091743
food (fermented)0.073394
china0.073394
india0.073394
hunter gatherer0.064220
rural community0.064220
state of rhode island0.055046
venezuela0.055046
amerindian0.055046
infant0.055046
obsolete_juvenile stage0.055046
pair of nares0.055046
farm0.055046
cold environment0.045872
arm0.045872
costa rica0.045872
monkey0.045872
canada0.045872
israel0.036697
gut content0.036697
12c0.036697
larvae insect diet0.036697
adult0.036697
sus scrofa0.036697
pig0.036697
united kingdom0.036697
bos taurus0.036697
age 5-13 years0.036697
bolivia0.036697
chuquisaca department0.036697
equus caballus0.036697
horse0.036697
control0.036697
coffea arabica0.027523
ecuador0.027523
LOWER IN control0.027523
fish feed0.027523
wild0.027523
zoological garden0.027523
mus musculus0.027523
mouse0.027523
wet season0.027523
LOWER IN dry season0.027523
age0.027523
forearm0.027523
nasal cavity0.027523
barn0.027523
hay0.027523
city0.027523
age 30-500.027523
age 60-790.027523
LOWER IN united states of america0.027523
LOWER IN mouth0.027523
kimchi0.018349
zea mays subsp. mays0.018349
corn0.018349
whole plant0.018349
floor0.018349
food processing factory0.018349
wet processing0.018349
canis lupus familiaris0.018349
dog0.018349
gastrointestinal system mucosa0.018349
butterfly0.018349
red pepper sauce0.018349
capsicum annuum0.018349
sichuan province0.018349
LOWER IN warm temperature habitat0.018349
new delhi0.018349
cebus capucinus0.018349
white-faced capuchin0.018349
age < 1 year0.018349
sudan0.018349
LOWER IN pre pupae insect diet0.018349
zambia0.018349
ethiopia0.018349
ensete ventricosum0.018349
ethiopian banana0.018349
early timepoint0.018349
aerobic fermentation0.018349
days 1-150.018349
foodon product type0.018349
cyprinus carpio0.018349
common carp0.018349
england0.018349
intestine0.018349
caecum0.018349
c57bl/6j0.018349
rumen0.018349
holstein-friesian bull0.018349
Exp. ID User ID Description Date Region Flag Sequences
311amnonhigher in fermneted kimchi days>1 compared to day 0 ( high in late timepoints days 1-9 compared to day 0 early timepoints in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 6
306amnonhigh freq. at whole plant corn at time 0 (highfreq zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 9
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
311amnonhigh freq. in floor of kimchi production facility (highfreq united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 10
313amnonhigh freq. in rainbow trout gut content grown in 12C water (highfreq sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 10
67amnonhigh freq. in wet processing of coffee beans (highfreq coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
75amnonhighfreq homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
131amnonpositively correlated with waist circumference ( high in waist circumference large waist circumference compared to small waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 12
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 13
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-10v4No1 / 14
501amnonhighfreq costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 14
547amnon high in low salt concentration compared to high salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
501amnonhighfreq costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 15
352amnonhighfreq homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
407amnonhighfreq costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
74amnoncommon spices, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 39
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 49
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in 605 days age compared to 660 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 80
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 116
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
384amnon high in barn hay compared to pasture in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 161
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229

Problems / suggestions? Please email info AT dbbact DOT org