Search result for sequence:
TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGTCTGAAGTGAAAGCCCTCAGCTCAACTGAGGAATTGCTTTGGAAACTGGATGACTTGAGTGCAGTAGAGGAAAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
homo sapiens0.178556
rainbow trout0.175182
oncorhynchus mykiss0.175182
feces0.165376
digestive system0.163305
fish0.161228
sweden0.153005
child0.134474
skin0.126582
india0.125984
food (fermented)0.124031
hunter gatherer0.114441
united states of america0.106870
rural community0.104478
venezuela0.098361
amerindian0.098361
state of rhode island0.096000
pair of nares0.092664
research facility0.090598
obsolete_juvenile stage0.090226
infant0.084806
arm0.082988
canada0.082988
cold environment0.081301
costa rica0.076628
monkey0.075188
farm0.071006
gut content0.066116
12c0.066116
larvae insect diet0.066116
chuquisaca department0.066116
age 5-13 years0.064000
china0.063547
bos taurus0.062016
bolivia0.062016
wild0.058968
horse0.058394
israel0.057554
equus caballus0.056738
sus scrofa0.053691
pig0.053691
united kingdom0.053691
fish feed0.051064
coffea arabica0.050420
hefei city prefecture0.050420
baijiu0.050420
wet season0.050420
LOWER IN dry season0.050420
forearm0.050420
barn0.050420
hay0.050420
age 30-500.050420
age 60-790.050420
fermentation pit mud0.049180
mud0.049180
LOWER IN mouth0.048583
ecuador0.048000
LOWER IN united states of america0.047431
zoological garden0.046875
age0.045455
nasal cavity0.042857
city0.042857
adult0.037915
mouse0.036364
mus musculus0.034884
kimchi0.034188
zea mays subsp. mays0.034188
corn0.034188
food processing factory0.034188
wet processing0.034188
gastrointestinal system mucosa0.034188
red pepper sauce0.034188
LOWER IN warm temperature habitat0.034188
new delhi0.034188
days 180-2700.034188
sudan0.034188
LOWER IN pre pupae insect diet0.034188
zambia0.034188
ensete ventricosum0.034188
ethiopian banana0.034188
aerobic fermentation0.034188
days 1-150.034188
cyprinus carpio0.034188
common carp0.034188
england0.034188
holstein-friesian bull0.034188
kebbi state0.034188
age 10-15 years0.034188
LOWER IN pasture0.034188
age 130.034188
size < 10um0.034188
clear day0.034188
LOWER IN finland0.034188
decaying0.034188
jiulong river0.034188
fujian province0.034188
foodon product type0.033898
whole plant0.033613
floor0.033613
butterfly0.033613
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
arm0.666667
venezuela0.666667
amerindian0.666667
fish feed0.666667
canada0.666667
india0.571429
state of rhode island0.500000
kimchi0.500000
days 1-90.500000
food (fermented)0.500000
zea mays subsp. mays0.500000
corn0.500000
rainbow trout0.500000
oncorhynchus mykiss0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
food processing factory0.500000
12c0.500000
cold environment0.500000
coffea arabica0.500000
wet processing0.500000
waist circumference0.500000
large waist circumference0.500000
LOWER IN small waist circumference0.500000
exocrine pancreatic insufficiency0.500000
gastrointestinal system mucosa0.500000
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
red pepper sauce0.500000
low salt concentration0.500000
LOWER IN high salt concentration0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
hamelia patens0.500000
firebush0.500000
new delhi0.500000
miso food product0.500000
hefei city prefecture0.500000
baijiu0.500000
days 180-2700.500000
sudan0.500000
larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN low human contact0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
aerobic fermentation0.500000
days 1-150.500000
spices0.500000
spice or herb0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
LOWER IN defatted larvae insect diet0.500000
defatted larvae insect diet0.500000
bangladesh0.500000
LOWER IN intestinal contents0.500000
przewalski horse0.500000
LOWER IN fishmeal diet0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
defatted larvae insects diet0.500000
red pepper0.500000
wet season0.500000
LOWER IN dry season0.500000
holstein-friesian bull0.500000
605 days0.500000
LOWER IN 660 days0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
chuquisaca department0.500000
forearm0.500000
dry processing0.500000
LOWER IN age one month0.500000
barn0.500000
hay0.500000
skh-1 hairless mouse0.500000
dorsum0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
low income0.500000
sewer0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
LOWER IN pasture0.500000
age 130.500000
size < 10um0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.336283
feces0.336283
united states of america0.185841
research facility0.150442
digestive system0.150442
sweden0.123894
fish0.123894
rainbow trout0.106195
oncorhynchus mykiss0.106195
china0.097345
child0.097345
skin0.088496
food (fermented)0.070796
india0.070796
hunter gatherer0.061947
rural community0.061947
state of rhode island0.053097
venezuela0.053097
amerindian0.053097
infant0.053097
obsolete_juvenile stage0.053097
pair of nares0.053097
farm0.053097
cold environment0.044248
arm0.044248
costa rica0.044248
monkey0.044248
canada0.044248
israel0.035398
gut content0.035398
12c0.035398
wild0.035398
larvae insect diet0.035398
adult0.035398
sus scrofa0.035398
pig0.035398
united kingdom0.035398
bos taurus0.035398
age 5-13 years0.035398
bolivia0.035398
chuquisaca department0.035398
equus caballus0.035398
horse0.035398
control0.035398
coffea arabica0.026549
ecuador0.026549
LOWER IN control0.026549
fish feed0.026549
hefei city prefecture0.026549
baijiu0.026549
fermentation pit mud0.026549
mud0.026549
zoological garden0.026549
mus musculus0.026549
mouse0.026549
wet season0.026549
LOWER IN dry season0.026549
age0.026549
forearm0.026549
nasal cavity0.026549
barn0.026549
hay0.026549
city0.026549
age 30-500.026549
age 60-790.026549
LOWER IN united states of america0.026549
LOWER IN mouth0.026549
kimchi0.017699
zea mays subsp. mays0.017699
corn0.017699
whole plant0.017699
floor0.017699
food processing factory0.017699
wet processing0.017699
canis lupus familiaris0.017699
dog0.017699
gastrointestinal system mucosa0.017699
butterfly0.017699
red pepper sauce0.017699
capsicum annuum0.017699
sichuan province0.017699
LOWER IN warm temperature habitat0.017699
new delhi0.017699
cebus capucinus0.017699
white-faced capuchin0.017699
age < 1 year0.017699
days 180-2700.017699
sudan0.017699
LOWER IN pre pupae insect diet0.017699
zambia0.017699
ethiopia0.017699
ensete ventricosum0.017699
ethiopian banana0.017699
early timepoint0.017699
aerobic fermentation0.017699
days 1-150.017699
foodon product type0.017699
cyprinus carpio0.017699
common carp0.017699
england0.017699
Exp. ID User ID Description Date Region Flag Sequences
311amnonhigher in fermneted kimchi days>1 compared to day 0 ( high in late timepoints days 1-9 compared to day 0 early timepoints in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 6
306amnonhigh freq. at whole plant corn at time 0 (dominant zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 9
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
311amnonhigh freq. in floor of kimchi production facility (dominant united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 10
313amnonhigh freq. in rainbow trout gut content grown in 12C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 10
67amnonhigh freq. in wet processing of coffee beans (dominant coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
131amnonpositively correlated with waist circumference ( high in waist circumference large waist circumference compared to small waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 12
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 13
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
501amnondominant costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 14
547amnon high in low salt concentration compared to high salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
501amnondominant costa rica, hamelia patens, firebush, flower, nectar2019-03-08v4No1 / 15
352amnondominant homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
407amnondominant costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
339amnoncommon homo sapiens, feces, infant, age < 1 year, india2018-05-24v4No1 / 19
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
603amnondominant in baijiu fermentation pit mud in later batches (dominant hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 23
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
74amnoncommon spices, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 39
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 49
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in 605 days age compared to 660 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 80
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 116
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
384amnon high in barn hay compared to pasture in equus caballus horse canada farm nasal cavity pair of nares 2018-10-22v4No1 / 161
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229

Problems / suggestions? Please email info AT dbbact DOT org