Search result for sequence:
TAGGGAATATTGCTCAATGGGGGAAACCCTGAAGCAGCAACGCCGCGTGGAGGATGAAGGTTTTAGGATTGTAAACTCCTTTTGTTAGAGAAGATAATGACGGTATCTAACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTA
common ontology terms
term enrichment score
TermScore
mucosa of stomach0.400000
helicobacter pylori infectious disease0.400000
romania0.400000
ursu lake0.400000
lake water0.333333
weaned0.307692
age 4-7 weeks0.307692
corn and soybean diet0.307692
depth 4-9m0.307692
hypersaline water0.307692
monimolimnion0.307692
jiangxi province0.266667
high salinity0.266667
south korea0.222222
biopsy0.222222
lake0.200000
helicobacter pylori0.181818
depth 0-3m0.181818
mixolimnion0.181818
LOWER IN age 13-15 years0.181818
LOWER IN depth 0-3m0.181818
LOWER IN mixolimnion0.181818
LOWER IN preweaned0.181818
LOWER IN suckling0.181818
LOWER IN age 2-4 weeks0.181818
low salinity0.166667
LOWER IN low salinity0.166667
pig0.148148
sus scrofa0.148148
oral cavity0.125000
LOWER IN child0.125000
stomach0.117647
pathogen0.100000
kingdom of spain0.090909
farm0.061538
saliva0.048780
water0.036364
homo sapiens0.020151
china0.017467
adult0.016949
feces0.008180
Fraction of dbbact annotations with this term covered by the query
TermScore
mucosa of stomach0.500000
helicobacter pylori0.500000
helicobacter pylori infectious disease0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
LOWER IN age 13-15 years0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
depth 4-9m0.500000
hypersaline water0.500000
monimolimnion0.500000
LOWER IN depth 0-3m0.500000
LOWER IN mixolimnion0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
lake water0.333333
low salinity0.333333
jiangxi province0.333333
high salinity0.333333
LOWER IN low salinity0.333333
south korea0.166667
biopsy0.166667
lake0.142857
oral cavity0.142857
LOWER IN child0.142857
pig0.111111
sus scrofa0.111111
pathogen0.090909
kingdom of spain0.076923
stomach0.071429
farm0.035714
saliva0.031250
water0.019231
homo sapiens0.010309
adult0.009174
china0.009091
feces0.004167
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.444444
south korea0.333333
mucosa of stomach0.333333
stomach0.333333
biopsy0.333333
helicobacter pylori infectious disease0.333333
lake0.333333
romania0.333333
ursu lake0.333333
water0.333333
lake water0.333333
pig0.222222
sus scrofa0.222222
feces0.222222
farm0.222222
jiangxi province0.222222
weaned0.222222
age 4-7 weeks0.222222
corn and soybean diet0.222222
china0.222222
depth 4-9m0.222222
high salinity0.222222
hypersaline water0.222222
monimolimnion0.222222
helicobacter pylori0.111111
pathogen0.111111
depth 0-3m0.111111
mixolimnion0.111111
low salinity0.111111
saliva0.111111
kingdom of spain0.111111
oral cavity0.111111
adult0.111111
LOWER IN child0.111111
LOWER IN age 13-15 years0.111111
LOWER IN depth 0-3m0.111111
LOWER IN mixolimnion0.111111
LOWER IN low salinity0.111111
LOWER IN preweaned0.111111
LOWER IN suckling0.111111
LOWER IN age 2-4 weeks0.111111
Exp. ID User ID Description Date Region Flag Sequences
569amnonHelicobacter pylori pathogen (other homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori, pathogen, helicobacter pylori infectious disease)2019-12-16v3No1 / 1
569amnonhigh freq. in gastric biopsies of patients positive for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 5
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 77
577amnoncommon lake, romania, ursu lake, water, lake water, depth 0-3m, mixolimnion, low salinity2020-01-09v3No1 / 130
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 232
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
577amnoncommon lake, romania, ursu lake, water, lake water, depth 4-9m, high salinity, hypersaline water, monimolimnion2020-01-09v3No1 / 303
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681

Problems / suggestions? Please email info AT dbbact DOT org