Search result for sequence:
TAGGGAATATTGCTCAATGGGGGAAACCCTGAAGCAGCAACGCCGCGTGGAGGATGAAGGTTTTAGGATTGTAAACTCCTTTTGTTAGAGAAGATAATGACGGTATCTAACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTA
common ontology terms
term enrichment score
TermScore
helicobacter pylori infectious disease0.428571
mucosa of stomach0.428571
ursu lake0.428571
romania0.428571
lake water0.352941
weaned0.333333
age 4-7 weeks0.333333
corn and soybean diet0.333333
monimolimnion0.333333
hypersaline water0.333333
depth 4-9m0.333333
jiangxi province0.285714
high salinity0.285714
south korea0.260870
biopsy0.230769
lake0.230769
helicobacter pylori0.200000
mixolimnion0.200000
depth 0-3m0.200000
LOWER IN mixolimnion0.200000
LOWER IN depth 0-3m0.200000
LOWER IN preweaned0.200000
LOWER IN suckling0.200000
LOWER IN age 2-4 weeks0.200000
low salinity0.181818
LOWER IN low salinity0.181818
pig0.153846
sus scrofa0.153846
stomach0.120000
pathogen0.105263
farm0.068966
water0.038710
china0.020202
homo sapiens0.011719
feces0.009174
Fraction of dbbact annotations with this term covered by the query
TermScore
helicobacter pylori infectious disease0.500000
helicobacter pylori0.500000
mucosa of stomach0.500000
mixolimnion0.500000
depth 0-3m0.500000
ursu lake0.500000
romania0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
monimolimnion0.500000
hypersaline water0.500000
depth 4-9m0.500000
LOWER IN mixolimnion0.500000
LOWER IN depth 0-3m0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
low salinity0.333333
lake water0.333333
jiangxi province0.333333
high salinity0.333333
LOWER IN low salinity0.333333
south korea0.200000
biopsy0.166667
lake0.166667
pig0.111111
sus scrofa0.111111
pathogen0.090909
stomach0.071429
farm0.040000
water0.020408
china0.010526
homo sapiens0.005952
feces0.004673
Fraction of annotations for the query sequences containing the term
TermScore
helicobacter pylori infectious disease0.375000
biopsy0.375000
stomach0.375000
mucosa of stomach0.375000
south korea0.375000
homo sapiens0.375000
lake water0.375000
water0.375000
ursu lake0.375000
romania0.375000
lake0.375000
pig0.250000
sus scrofa0.250000
feces0.250000
farm0.250000
jiangxi province0.250000
weaned0.250000
age 4-7 weeks0.250000
corn and soybean diet0.250000
china0.250000
monimolimnion0.250000
hypersaline water0.250000
high salinity0.250000
depth 4-9m0.250000
pathogen0.125000
helicobacter pylori0.125000
low salinity0.125000
mixolimnion0.125000
depth 0-3m0.125000
LOWER IN low salinity0.125000
LOWER IN mixolimnion0.125000
LOWER IN depth 0-3m0.125000
LOWER IN preweaned0.125000
LOWER IN suckling0.125000
LOWER IN age 2-4 weeks0.125000
Exp. ID User ID Description Date Region Flag Sequences
569amnonHelicobacter pylori pathogen (other helicobacter pylori infectious disease, pathogen, helicobacter pylori, biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 1
569amnonhigh freq. in gastric biopsies of patients positive for h. pylori (dominant helicobacter pylori infectious disease, biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 5
569amnoncommon in gastric biopsies of patients positive for h. pylori (common helicobacter pylori infectious disease, biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 77
577amnoncommon low salinity, mixolimnion, depth 0-3m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 130
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
577amnoncommon monimolimnion, hypersaline water, high salinity, depth 4-9m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 303
577amnon high in monimolimnion depth 4-9m high salinity hypersaline water compared to low salinity mixolimnion depth 0-3m in lake water water ursu lake romania lake 2020-01-09v3No1 / 439
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681

Problems / suggestions? Please email info AT dbbact DOT org