Search result for sequence:
TAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGTAGTAACTGGCCTTTATTTGACGGTAATCAACCAGAAAGTCACGGC
common ontology terms
term enrichment score
TermScore
gallus gallus0.347410
chicken0.347410
research facility0.221299
canis lupus familiaris0.193548
homo sapiens0.193329
feces0.191687
dog0.178394
caecum0.159122
united states of america0.151459
china0.147658
female0.147566
adult0.143618
vagina0.124691
ileum0.121314
broiler chicken0.119972
farm0.105516
skin0.104508
hen0.085409
pig0.081356
sus scrofa0.075257
age 35 weeks0.070671
captive0.067340
age 35 days0.065099
italy0.064935
united kingdom0.063247
rat0.060201
poland0.057348
duodenum0.057021
germany0.056483
canada0.055215
mexico0.054983
digesta0.054983
infant0.051447
cobb broiler chicken0.050542
foxhound0.050542
pregnancy0.050036
rural community0.049911
child0.049906
LOWER IN caecum0.049499
city of melbourne0.049296
air0.049296
rattus norvegicus0.048894
city0.048343
phoenix0.043636
small intestine0.043636
state of texas0.043321
kingdom of spain0.043197
province of ontario0.042705
sprague dawley0.042403
state of arizona0.041812
epidermis0.041812
bird0.040956
colon0.040747
male0.040632
age0.039344
age 25-45 years0.036969
dust0.036969
jejunum0.036855
pet0.036630
free range chicken0.036630
new york city0.035651
state of minnesota0.035651
stomach0.035336
belgium0.035336
whole body0.035026
pair of nares0.034924
australia0.033573
wild0.033003
control0.032498
age 2 weeks0.029740
ismailia0.029520
jinzhou city prefecture0.029520
chuquisaca department0.029520
rhesus macaque0.029520
minqin county0.029520
age 6 weeks0.029304
beetle0.029091
age 5-13 years0.029091
ph 90.029091
india0.028674
jiangxi province0.028674
bolivia0.028674
depth 0.5m0.028674
mucosa0.028269
high fiber0.028269
zoological garden0.028269
nasal cavity0.028070
egypt0.027875
macaca mulatta0.027875
austria0.027491
LOWER IN feces0.027491
sand0.027491
desert0.027119
monkey0.026403
rhizosphere0.022792
urine0.022388
cocoa mass0.022305
theobroma cacao0.022305
state of tabasco0.022305
time 5 days0.022305
Fraction of dbbact annotations with this term covered by the query
TermScore
gallus gallus0.875000
chicken0.875000
broiler chicken0.833333
vagina0.700000
age 2 weeks0.666667
age 35 days0.666667
age 25-45 years0.666667
dust0.666667
hen0.666667
fish feed0.666667
high protein diet0.666667
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
jejunum0.600000
urine0.600000
ileum0.533333
cheese curd0.500000
cheddar cheese food product0.500000
ant0.500000
pseudomyrmex cubaensis0.500000
phoenix0.500000
cobb broiler chicken0.500000
pseudomyrmex elongatus0.500000
ismailia0.500000
non-pregnant0.500000
small intestine0.500000
jinzhou city prefecture0.500000
cervical carcinoma0.500000
invasive carcinoma0.500000
invasive cervical carcinoma0.500000
dysplasia of cervix0.500000
chest0.500000
torso0.500000
pregnancy trimester 20.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
time 5 days0.500000
fermented cocoa mass0.500000
exocrine pancreatic insufficiency0.500000
age 90 weeks0.500000
age 35 weeks0.500000
ileal mucosa0.500000
pet0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN before hsct0.500000
enzyme supplementation0.500000
new delhi0.500000
sus scrofa domesticus0.500000
upper leg skin0.500000
inner thigh0.500000
age <= 24 hours0.500000
age 5 weeks0.500000
melopsittacus undulatus0.500000
parakeet0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
age 60 weeks0.500000
domestic0.500000
thermophilic sediment0.500000
yellowstone national park0.500000
dog breeding center0.500000
lethbridge0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age 15 - 35 days0.500000
fifth decade human stage0.500000
acute severe colitis0.500000
great britain0.500000
age 42 days0.500000
foxhound0.500000
low fiber0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
kebbi state0.500000
dog food diet0.500000
LOWER IN raw meat diet0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
skin of forehead0.500000
cheek0.500000
panthera tigris0.500000
tiger0.500000
LOWER IN high wellfare feed0.500000
serinus canaria0.500000
canary0.500000
upper eyelid0.500000
culicoides <genus>0.500000
culicoides batesi0.500000
biting midge0.500000
poland0.500000
aphthona venustula0.500000
nida basin0.500000
herbivorous beetle0.500000
lymphoma0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.349810
homo sapiens0.273764
research facility0.269962
united states of america0.235741
gallus gallus0.216730
chicken0.216730
adult0.163498
china0.163498
canis lupus familiaris0.125475
dog0.114068
caecum0.110266
female0.102662
farm0.083650
vagina0.068441
ileum0.068441
broiler chicken0.064639
skin0.064639
pig0.045627
hen0.045627
sus scrofa0.041825
germany0.041825
age 35 weeks0.038023
italy0.038023
captive0.038023
kingdom of spain0.038023
male0.034221
age 35 days0.034221
canada0.034221
rat0.034221
united kingdom0.034221
control0.030418
duodenum0.030418
mexico0.030418
digesta0.030418
infant0.030418
child0.030418
poland0.030418
cobb broiler chicken0.026616
pregnancy0.026616
rattus norvegicus0.026616
LOWER IN caecum0.026616
australia0.026616
city of melbourne0.026616
foxhound0.026616
city0.026616
rural community0.026616
air0.026616
state of arizona0.022814
phoenix0.022814
small intestine0.022814
province of ontario0.022814
epidermis0.022814
bird0.022814
age0.022814
colon0.022814
sprague dawley0.022814
state of texas0.022814
stomach0.019011
age 25-45 years0.019011
jejunum0.019011
dust0.019011
pet0.019011
new york city0.019011
wild0.019011
belgium0.019011
state of minnesota0.019011
whole body0.019011
pair of nares0.019011
free range chicken0.019011
austria0.015209
age 2 weeks0.015209
egypt0.015209
ismailia0.015209
jinzhou city prefecture0.015209
LOWER IN control0.015209
mucosa0.015209
india0.015209
nasal cavity0.015209
jiangxi province0.015209
high fiber0.015209
beetle0.015209
zoological garden0.015209
bolivia0.015209
chuquisaca department0.015209
age 5-13 years0.015209
LOWER IN feces0.015209
macaca mulatta0.015209
monkey0.015209
rhesus macaque0.015209
age 6 weeks0.015209
desert0.015209
rhizosphere0.015209
depth 0.5m0.015209
minqin county0.015209
sand0.015209
ph 90.015209
soil0.015209
larval stage0.011407
age 4 weeks0.011407
hospital0.011407
Exp. ID User ID Description Date Region Flag Sequences
74amnoncommon united states of america, cheese curd, foodon product type, cheddar cheese food product2017-02-27v4No1 / 4
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 7
535amnoncommon in healthy adult vaginal samples (common homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 7
497amnondominant feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 9
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
497amnondominant feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 10
724amnondominant homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 10
780amnondominant research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 10
191amnondominant homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
301amnondominant united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 12
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 12
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
808amnondominant research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 13
7amnondominant homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (dominant feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
655amnon high in after hcst hematopoietic stem cell transplant compared to before hsct in feces homo sapiens italy 2020-09-13v3No1 / 15
808amnondominant research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 15
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 16
213amnondominant homo sapiens, vagina, south africa2017-10-22v4No1 / 16
352amnondominant feces, homo sapiens, new delhi, india2018-07-30v4No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 16
528amnondominant homo sapiens, united states of america, female, pregnancy, vagina2019-07-14v1No1 / 16
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
724amnoncommon homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 17
776amnondominant research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 17
302amnonhigh freq. in feces of parakeet pet birds (dominant feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 18
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
795amnoncommon research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 19
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
666amnondominant feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
497amnoncommon feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
61amnondominant united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 23
198amnondominant united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
738amnondominant caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 23
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
756amnondominant research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 24
723amnondominant homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
379amnondominant feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
488amnondominant feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 28
622amnon high in ileum compared to caecum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 29
191amnoncommon homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 34
759amnon high in dog food diet compared to raw meat diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 35
789amnoncommon in traditionally harvested cocoa pulp after fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 35
180amnoncommon adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
497amnoncommon feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 39
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
674amnoncommon female, body proper, panama, whole body, culicoides <genus>, culicoides batesi, biting midge2020-09-28v4No1 / 48
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
808amnoncommon research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 59
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
738amnoncommon caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 64
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
808amnoncommon research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 72
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in forager chepang compared to tharu agrarian in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 73
279amnoncommon stomach, small intestine, ochotonidae, pika, china2018-01-24v4No1 / 77
822amnon high in high fiber compared to hydrolized diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 79
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 88
495amnon high in broiler chicken compared to free range chicken in farm caecum gallus gallus kingdom of spain chicken age 3 weeks 2019-03-03v4No1 / 90
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
17amnon high in low altitude compared to high altitude in feces stomach ochotona tibetan plateau 2016-11-09v4No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, vagina, south africa2017-10-22v4No1 / 103
279amnoncommon ochotonidae, pika, mouth, china2018-01-24v4No1 / 103
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 120
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 134
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
108amnoncommon united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 158
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
379amnoncommon feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 4 weeks, broiler chicken2019-03-03v4No1 / 185
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
776amnoncommon caecum, gallus gallus, hawaii, chicken, wild, age 15-20 weeks, feral2021-04-25v3No1 / 191
808amnon high in digesta compared to mucosa ileal mucosa in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 192
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 210
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 214
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
808amnon high in ileum compared to caecum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 3 weeks, free range chicken2019-03-03v4No1 / 236
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
808amnon high in digesta compared to mucosa in research facility caecum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 266
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 290
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
756amnoncommon research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 321
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
792amnoncommon desert, rhizosphere, depth 0.5m, china, minqin county, sand, nitraria tangutorum, ph 92021-06-07v4No1 / 352
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
808amnoncommon research facility, caecum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 406
560amnoncommon united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 419
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth 0.5m china minqin county sand ph 9 2021-06-07v4No1 / 432
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
792amnoncommon desert, rhizosphere, depth 0.5m, china, minqin county, sand, haloxylon ammodendron, ph 92021-06-07v4No1 / 443
808amnoncommon research facility, mucosa, caecum, gallus gallus, germany, chicken, age 35 weeks, hen2021-06-20v1No1 / 446
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
792amnoncommon desert, soil, depth 0.5m, china, minqin county, sand, ph 92021-06-07v4No1 / 595
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros ceratotherium simum simum in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 656
25amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, sichuan province2016-12-01v4No1 / 669
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
632amnoncommon united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 914
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893

Problems / suggestions? Please email info AT dbbact DOT org