Search result for sequence:
TAGGGAATCTTCCACAATGGGCGCAAGCCTGATGGAGCAACACCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAGCTCTGTTGTTGGAGAAGAACGTGCGTGAGAGTAACTGTTCACGCAGTGACGGTATCCAACCAGAAAGTCACGGC
common ontology terms
term enrichment score
TermScore
gallus gallus0.468619
chicken0.468619
caecum0.197260
research facility0.185436
ileum0.175000
age 6 weeks0.165517
broiler chicken0.159190
pig0.130178
united kingdom0.129032
new zealand0.111801
lamb0.111801
sweden0.109756
mexico0.104575
sus scrofa0.104046
age 35 days0.103321
hen0.103321
kingdom of spain0.097297
farm0.090566
jejunum0.088889
cobb broiler chicken0.087591
sheep0.083721
feces0.081687
duodenum0.081633
ovis aries0.077253
cold environment0.074074
pet0.074074
age 35 weeks0.074074
germany0.073733
homo sapiens0.070599
digesta0.070175
rat0.069364
china0.069289
oncorhynchus mykiss0.068966
rainbow trout0.068966
LOWER IN caecum0.068376
male0.063768
oral cavity0.062500
canada0.062500
12c0.060150
bird0.057143
rattus norvegicus0.057143
sprague dawley0.057143
jiangxi province0.056738
italy0.055777
captive0.054176
oral wash0.052288
fish0.051282
state of new york0.048485
saliva0.047619
age 2 weeks0.046332
gut content0.045802
cocoa mass0.045802
theobroma cacao0.045802
state of tabasco0.045802
time 5 days0.045802
fermented cocoa mass0.045802
suckling0.045802
preweaned0.045802
age 2-4 weeks0.045802
seattle0.045802
colonized germ free0.045802
janvier labs0.045802
age 1 week0.045802
algonquin provincial park0.045802
peromyscus maniculatus0.045802
deer mice0.045802
size < 10um0.045802
province of ontario0.044776
age 3-5 weeks0.044776
dust0.044776
gastrointestinal system0.044280
cloaca0.043321
adult0.042837
mouse0.041379
belgium0.040268
wild0.040268
brazil0.039088
c57bl/6j0.038710
mus musculus0.038585
control0.038272
digestive system0.037736
air0.037267
israel0.034091
female0.032389
standard feed0.031250
LOWER IN 13-year-old human stage0.031250
LOWER IN 14-year-old human stage0.031250
gastrointestinal system mucosa0.031008
nymphicus hollandicus0.031008
cockatiel0.031008
LOWER IN warm temperature habitat0.031008
sus scrofa domesticus0.031008
melopsittacus undulatus0.031008
parakeet0.031008
pulpitis0.031008
cftr s489x0.031008
age 60 weeks0.031008
age 15 - 35 days0.031008
induced type 1 diabetes0.031008
LOWER IN high sugar diet0.031008
Fraction of dbbact annotations with this term covered by the query
TermScore
gallus gallus0.875000
chicken0.875000
broiler chicken0.833333
age 35 days0.666667
hen0.666667
age 2 weeks0.666667
standard feed0.666667
LOWER IN 13-year-old human stage0.666667
LOWER IN 14-year-old human stage0.666667
age 6 weeks0.600000
jejunum0.600000
cobb broiler chicken0.500000
gut content0.500000
12c0.500000
cold environment0.500000
tylosin phosphate0.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
time 5 days0.500000
fermented cocoa mass0.500000
gastrointestinal system mucosa0.500000
pet0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
sus scrofa domesticus0.500000
melopsittacus undulatus0.500000
parakeet0.500000
ismailia0.500000
pregnancy trimester 20.500000
pulpitis0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
age 60 weeks0.500000
age 15 - 35 days0.500000
induced type 1 diabetes0.500000
very high sugar diet0.500000
LOWER IN high sugar diet0.500000
janvier labs0.500000
age 18 weeks0.500000
great britain0.500000
age 42 days0.500000
LOWER IN induced type 1 diabetes0.500000
tooth0.500000
panthera tigris0.500000
tiger0.500000
LOWER IN high wellfare feed0.500000
age 1 week0.500000
serinus canaria0.500000
canary0.500000
LOWER IN hard palate0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
age 35 weeks0.500000
ileal mucosa0.500000
free range chicken0.500000
age 4 days0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN 6-12 year-old child stage0.500000
common bottlenose dolphin0.500000
LOWER IN 18-month-old human stage0.500000
municipality of umea0.500000
LOWER IN free range chicken0.500000
felis silvestris0.500000
wild cat0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
istanbul0.500000
LOWER IN sucram0.500000
high sugar diet0.500000
LOWER IN influenza0.500000
mallard0.500000
cholelithiasis0.500000
bile0.500000
gallbladder0.500000
jinzhou city prefecture0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
vulpes vulpes0.500000
lake hulun0.500000
red fox0.500000
apodemus sylvaticus0.500000
wood mouse0.500000
clear day0.500000
LOWER IN dust day0.500000
size < 10um0.500000
LOWER IN external naris0.500000
age 15-20 weeks0.500000
feral0.500000
LOWER IN ileal mucosa0.500000
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.432000
feces0.352000
gallus gallus0.320000
chicken0.320000
caecum0.160000
china0.152000
homo sapiens0.152000
ileum0.112000
farm0.096000
age 6 weeks0.096000
broiler chicken0.088000
male0.088000
pig0.088000
united kingdom0.080000
kingdom of spain0.072000
ovis aries0.072000
new zealand0.072000
sheep0.072000
lamb0.072000
sweden0.072000
sus scrofa0.072000
adult0.072000
mexico0.064000
united states of america0.064000
germany0.064000
age 35 days0.056000
control0.056000
italy0.056000
hen0.056000
jejunum0.048000
cobb broiler chicken0.048000
duodenum0.048000
rat0.048000
mus musculus0.048000
mouse0.048000
digestive system0.040000
oncorhynchus mykiss0.040000
fish0.040000
rainbow trout0.040000
cold environment0.040000
bird0.040000
pet0.040000
rattus norvegicus0.040000
sprague dawley0.040000
digesta0.040000
LOWER IN caecum0.040000
oral cavity0.040000
age 35 weeks0.040000
canada0.040000
12c0.032000
female0.032000
jiangxi province0.032000
oral wash0.032000
state of new york0.032000
saliva0.032000
captive0.032000
gut content0.024000
LOWER IN control0.024000
belgium0.024000
cocoa mass0.024000
theobroma cacao0.024000
state of tabasco0.024000
time 5 days0.024000
fermented cocoa mass0.024000
cloaca0.024000
brazil0.024000
suckling0.024000
preweaned0.024000
age 2-4 weeks0.024000
seattle0.024000
colonized germ free0.024000
age 2 weeks0.024000
c57bl/6j0.024000
janvier labs0.024000
age 1 week0.024000
province of ontario0.024000
algonquin provincial park0.024000
peromyscus maniculatus0.024000
deer mice0.024000
age 3-5 weeks0.024000
gastrointestinal system0.024000
wild0.024000
air0.024000
dust0.024000
israel0.024000
size < 10um0.024000
colon0.016000
gastrointestinal system mucosa0.016000
cecal content0.016000
nymphicus hollandicus0.016000
cockatiel0.016000
fish feed0.016000
LOWER IN warm temperature habitat0.016000
sus scrofa domesticus0.016000
melopsittacus undulatus0.016000
parakeet0.016000
age 1 month0.016000
dentition0.016000
mouth0.016000
pulpitis0.016000
Exp. ID User ID Description Date Region Flag Sequences
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 6
649amnondominant research facility, jejunum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 6
649amnondominant research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 9
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
313amnonhigh freq. in rainbow trout gut content grown in 12C water (dominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 10
649amnondominant research facility, duodenum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 10
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 10
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 12
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
302amnonhigh freq. in feces of Cockatiel pet birds (dominant feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 15
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
302amnonhigh freq. in feces of parakeet pet birds (dominant feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 18
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
105amnondominant homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
497amnoncommon feces, farm, gallus gallus, austria, chicken, age 4 weeks, broiler chicken2019-03-04v4No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
379amnondominant feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet western diet very high sugar diet compared to high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 28
622amnon high in ileum compared to caecum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 29
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
789amnoncommon in traditionally harvested cocoa pulp after fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 35
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 38
649amnoncommon research facility, jejunum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 38
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
497amnoncommon feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 39
95amnoncommon in root canal (common homo sapiens, tooth, brazil, root canal)2017-03-12v4No1 / 42
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
649amnoncommon research facility, duodenum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 47
806amnon high in oral cavity oral wash compared to hard palate in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 48
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
649amnoncommon research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 55
806amnon high in oral cavity oral wash compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 58
808amnoncommon research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 58
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
738amnoncommon caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 64
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
808amnoncommon research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 72
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
495amnon high in broiler chicken compared to free range chicken in farm caecum gallus gallus kingdom of spain chicken age 3 weeks 2019-03-03v4No1 / 90
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 96
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
704amnon high in dental caries compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 102
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
537amnoncommon in feces of captive grown deer mice feces (common feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 121
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 2 weeks2019-03-03v4No1 / 134
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
379amnoncommon feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 163
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 163
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in air dust israel size < 10um )2017-10-04v4No1 / 173
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
776amnoncommon caecum, gallus gallus, hawaii, chicken, wild, age 15-20 weeks, feral2021-04-25v3No1 / 191
808amnon high in digesta compared to mucosa ileal mucosa in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 192
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, broiler chicken, age 6 weeks2019-03-03v4No1 / 210
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
808amnon high in ileum compared to caecum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 224
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years 13-year-old human stage 14-year-old human stage in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
622amnoncommon research facility, caecum, gallus gallus, chicken, great britain, liverpool, age 42 days2020-05-08v4No1 / 244
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
806amnon high in oral cavity oral wash compared to gingiva keratinized gingiva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 288
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
756amnoncommon research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 321
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 325
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1672
696amnon high in alycaeus jagori compared to georissa georissa similis in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1698

Problems / suggestions? Please email info AT dbbact DOT org