Search result for sequence:
TAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC
common ontology terms
term enrichment score
TermScore
saliva0.443117
homo sapiens0.405668
child0.311927
adult0.241872
mouth0.157895
mouth mucosa0.154639
venezuela0.138996
amerindian0.138996
hunter gatherer0.134328
sweden0.128655
infant0.128179
africa0.125874
bolivia0.121212
skin0.117428
china0.105010
czech republic0.099644
LOWER IN dentition0.096463
australia0.093802
chuquisaca department0.093750
duodenum0.092715
age 5-13 years0.089552
feces0.084791
LOWER IN supragingival plaque0.081800
stunted growth0.079365
oral cavity0.078329
united states of america0.076190
pair of nares0.074442
dentition0.071556
rural community0.070588
LOWER IN control0.069498
city0.068493
antananarivo0.064516
madagascar0.064516
msm0.064516
homosexual0.064516
hiv infection0.062500
LOWER IN saliva0.061224
LOWER IN feces0.057143
arm0.049793
LOWER IN supragingival dental plaque0.049793
canada0.049793
buccal mucosa0.049180
late adult stage0.049180
age 2 years0.049180
perth0.049180
recurrent otitis media0.049180
central african republic0.049180
bangui0.049180
sichuan province0.048780
age 6 months0.048000
age 1-3 years0.048000
subgingival plaque0.047619
male0.046332
nasopharynx0.045802
LOWER IN adult0.044776
kingdom of spain0.044280
stomach0.043796
LOWER IN city0.043796
mucus0.043796
LOWER IN united states of america0.041958
poland0.033898
age 3 months0.033333
cheek0.033333
age 13-15 years0.033333
urban biome0.033333
age 7-14 years0.033333
rectal swab0.033333
LOWER IN central african republic0.033333
LOWER IN bangui0.033333
shanghai district0.033333
gay0.033333
forearm0.033333
LOWER IN russia0.033333
age 30-500.033333
age 60-790.033333
age 20-30 years0.033333
LOWER IN heterosexual0.033058
LOWER IN msw0.033058
female0.032967
amsterdam0.032787
atlanta0.032787
tongue0.032787
shanghai proper0.032787
age < 3 years0.032787
mouth neoplasm0.032787
cancer0.032787
toronto0.032787
belgium0.032520
india0.032520
finland0.032520
LOWER IN skin0.032258
nasal cavity0.032000
age 1 year0.030769
control0.030769
brazil0.030534
obsolete_juvenile stage0.029412
age0.029197
state of california0.025974
dental caries0.016949
ixodes ornithorhynchi0.016949
Fraction of dbbact annotations with this term covered by the query
TermScore
poland1.000000
LOWER IN supragingival plaque0.800000
mouth mucosa0.750000
LOWER IN dentition0.714286
venezuela0.666667
amerindian0.666667
arm0.666667
LOWER IN supragingival dental plaque0.666667
canada0.666667
saliva0.593750
buccal mucosa0.500000
bolivia0.500000
chuquisaca department0.500000
late adult stage0.500000
dental caries0.500000
ixodes ornithorhynchi0.500000
age 2 years0.500000
perth0.500000
recurrent otitis media0.500000
hunter gatherer0.500000
age 3 months0.500000
antananarivo0.500000
madagascar0.500000
stunted growth0.500000
central african republic0.500000
bangui0.500000
induced sputum0.500000
LOWER IN oral wash0.500000
middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
LOWER IN age 7 years0.500000
formula fed0.500000
LOWER IN breast fed0.500000
cheek0.500000
age 13-15 years0.500000
nicotiana galuca0.500000
short bowel syndrome0.500000
lower labial mucosa0.500000
urban biome0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN skin under eye0.500000
age 7-14 years0.500000
rectal swab0.500000
msm0.500000
homosexual0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
south florida0.500000
shark0.500000
cameroon0.500000
train0.500000
boston0.500000
olsztyn0.500000
gut0.500000
esox lucius0.500000
pike fry0.500000
shanghai district0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
gay0.500000
forearm0.500000
LOWER IN subgingival plaque0.500000
LOWER IN russia0.500000
bangladesh0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
estonia0.500000
anterior naris0.500000
LOWER IN sinusitis0.500000
LOWER IN chronic rhinosinusitis0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age &gt;940.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
cloud0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age 20-30 years0.500000
toronto zoo0.500000
new delhi0.500000
LOWER IN age &lt;1 year0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
oral cavity0.428571
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.887931
saliva0.353448
adult0.301724
child0.293103
feces0.155172
china0.146552
united states of america0.137931
mouth0.103448
sweden0.094828
mouth mucosa0.086207
LOWER IN control0.077586
infant0.077586
venezuela0.077586
hunter gatherer0.077586
amerindian0.077586
africa0.077586
skin0.077586
bolivia0.068966
czech republic0.060345
australia0.060345
duodenum0.060345
age 5-13 years0.051724
rural community0.051724
chuquisaca department0.051724
LOWER IN dentition0.051724
dentition0.043103
city0.043103
stunted growth0.043103
pair of nares0.043103
oral cavity0.043103
LOWER IN supragingival plaque0.043103
control0.034483
antananarivo0.034483
madagascar0.034483
LOWER IN saliva0.034483
hiv infection0.034483
msm0.034483
homosexual0.034483
LOWER IN feces0.034483
buccal mucosa0.025862
subgingival plaque0.025862
late adult stage0.025862
age 6 months0.025862
age 2 years0.025862
nasopharynx0.025862
age 1-3 years0.025862
perth0.025862
recurrent otitis media0.025862
stomach0.025862
central african republic0.025862
bangui0.025862
LOWER IN city0.025862
LOWER IN united states of america0.025862
LOWER IN adult0.025862
kingdom of spain0.025862
mucus0.025862
male0.025862
sichuan province0.025862
female0.025862
arm0.025862
LOWER IN supragingival dental plaque0.025862
canada0.025862
amsterdam0.017241
brazil0.017241
age 1 year0.017241
age 3 months0.017241
belgium0.017241
nasal cavity0.017241
atlanta0.017241
cheek0.017241
india0.017241
age 13-15 years0.017241
tongue0.017241
obsolete_juvenile stage0.017241
urban biome0.017241
LOWER IN skin0.017241
shanghai proper0.017241
age 7-14 years0.017241
rectal swab0.017241
LOWER IN central african republic0.017241
LOWER IN bangui0.017241
poland0.017241
shanghai district0.017241
age0.017241
gay0.017241
LOWER IN heterosexual0.017241
LOWER IN msw0.017241
forearm0.017241
state of california0.017241
age < 3 years0.017241
finland0.017241
LOWER IN russia0.017241
mouth neoplasm0.017241
cancer0.017241
age 30-500.017241
age 60-790.017241
age 20-30 years0.017241
toronto0.017241
aphthous stomatitis0.008621
LOWER IN periodontitis0.008621
Exp. ID User ID Description Date Region Flag Sequences
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 2
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
621amnondominant ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 10
596amnondominant homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 12
576amnondominant homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 14
596amnondominant homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 14
605amnoncommon australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
596amnon high in age 6 months compared to age 3 months in homo sapiens sweden saliva child 2020-03-18v3No1 / 15
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
596amnoncommon homo sapiens, sweden, saliva, child, age 3 months2020-03-17v3No1 / 21
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens czech republic adult 2020-01-09v3No1 / 22
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v3No1 / 24
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
596amnon high in age 2 years compared to age 7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
596amnoncommon homo sapiens, sweden, saliva, child, age 6 months, infant2020-03-17v3No1 / 35
596amnoncommon homo sapiens, sweden, saliva, child, age 1 year2020-03-17v3No1 / 36
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
598amnonhigher in mouthwash of students compared to teachers ( high in child age 13-15 years compared to adult in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 52
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
596amnoncommon homo sapiens, sweden, saliva, child, age 2 years2020-03-17v3No1 / 57
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
596amnoncommon homo sapiens, sweden, saliva, child, age 7 years2020-03-17v3No1 / 59
576amnoncommon homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 66
576amnoncommon homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 67
576amnoncommon homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
598amnoncommon child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
605amnon high in recurrent otitis media compared to control in australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 149
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 291
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org