Search result for sequence:
TAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC
common ontology terms
term enrichment score
TermScore
homo sapiens0.416213
saliva0.344942
adult0.252235
child0.224852
mouth mucosa0.188088
mouth0.186047
venezuela0.169014
amerindian0.169014
hunter gatherer0.162162
africa0.162162
bolivia0.146789
skin0.143836
infant0.122807
czech republic0.119149
chuquisaca department0.114286
duodenum0.112450
age 5-13 years0.108108
china0.098940
feces0.098476
stunted growth0.097087
pair of nares0.089820
dentition0.089485
rural community0.088889
united states of america0.086978
city0.082418
homosexual0.080268
msm0.080268
antananarivo0.079208
madagascar0.079208
hiv infection0.077170
LOWER IN saliva0.076190
LOWER IN control0.072072
LOWER IN feces0.070796
arm0.061538
LOWER IN dentition0.061224
buccal mucosa0.060606
late adult stage0.060606
central african republic0.060606
bangui0.060606
male0.059701
oral cavity0.058824
subgingival plaque0.058252
LOWER IN city0.054054
mucus0.054054
stomach0.052632
australia0.051948
LOWER IN united states of america0.051282
LOWER IN supragingival plaque0.041667
amsterdam0.041237
cheek0.041237
urban biome0.041237
age 7-14 years0.041237
rectal swab0.041237
LOWER IN central african republic0.041237
LOWER IN bangui0.041237
gay0.041237
LOWER IN heterosexual0.041237
LOWER IN msw0.041237
forearm0.041237
LOWER IN russia0.041237
age 30-500.041237
age 60-790.041237
atlanta0.040404
LOWER IN skin0.040404
shanghai proper0.040404
sichuan province0.040404
age < 3 years0.040404
mouth neoplasm0.040404
cancer0.040404
belgium0.040000
india0.040000
finland0.040000
nasal cavity0.039216
brazil0.037383
LOWER IN adult0.036364
control0.035874
age0.035714
obsolete_juvenile stage0.035398
state of california0.030534
dental caries0.021053
induced sputum0.021053
LOWER IN oral wash0.021053
formula fed0.021053
LOWER IN breast fed0.021053
nicotiana galuca0.021053
short bowel syndrome0.021053
lower labial mucosa0.021053
LOWER IN kitchen0.021053
LOWER IN sink0.021053
bathroom0.021053
shower0.021053
tile0.021053
building wall0.021053
LOWER IN inguinal region0.021053
LOWER IN axilla0.021053
LOWER IN sebum0.021053
LOWER IN skin under eye0.021053
south florida0.021053
shark0.021053
train0.021053
Fraction of dbbact annotations with this term covered by the query
TermScore
mouth mucosa0.750000
venezuela0.666667
amerindian0.666667
arm0.666667
LOWER IN supragingival plaque0.666667
LOWER IN dentition0.600000
homosexual0.600000
msm0.600000
saliva0.520000
buccal mucosa0.500000
amsterdam0.500000
bolivia0.500000
chuquisaca department0.500000
late adult stage0.500000
dental caries0.500000
hunter gatherer0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
stunted growth0.500000
central african republic0.500000
bangui0.500000
induced sputum0.500000
LOWER IN oral wash0.500000
formula fed0.500000
LOWER IN breast fed0.500000
cheek0.500000
nicotiana galuca0.500000
short bowel syndrome0.500000
lower labial mucosa0.500000
urban biome0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN skin under eye0.500000
age 7-14 years0.500000
rectal swab0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
south florida0.500000
shark0.500000
train0.500000
boston0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
gay0.500000
LOWER IN heterosexual0.500000
LOWER IN msw0.500000
forearm0.500000
LOWER IN subgingival plaque0.500000
LOWER IN russia0.500000
bangladesh0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
estonia0.500000
LOWER IN chronic rhinosinusitis0.500000
LOWER IN sinusitis0.500000
anterior naris0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age >940.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
cloud0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
toronto zoo0.500000
canada0.500000
new delhi0.500000
LOWER IN age <1 year0.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
male0.400000
hiv infection0.375000
aphthous stomatitis0.333333
age 5-13 years0.333333
mouth0.333333
LOWER IN tongue0.333333
sputum0.333333
LOWER IN saliva0.333333
kingdom of the netherlands0.333333
infant0.333333
LOWER IN breast milk0.333333
atlanta0.333333
nectar0.333333
lip0.333333
oral cavity0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.913978
adult0.311828
saliva0.258065
child0.204301
feces0.193548
united states of america0.172043
china0.150538
mouth0.129032
mouth mucosa0.107527
venezuela0.096774
hunter gatherer0.096774
amerindian0.096774
africa0.096774
skin0.096774
LOWER IN control0.086022
bolivia0.086022
czech republic0.075269
duodenum0.075269
infant0.075269
age 5-13 years0.064516
rural community0.064516
chuquisaca department0.064516
dentition0.053763
city0.053763
stunted growth0.053763
pair of nares0.053763
control0.043011
antananarivo0.043011
madagascar0.043011
LOWER IN saliva0.043011
hiv infection0.043011
homosexual0.043011
msm0.043011
LOWER IN feces0.043011
buccal mucosa0.032258
subgingival plaque0.032258
late adult stage0.032258
stomach0.032258
central african republic0.032258
bangui0.032258
LOWER IN city0.032258
LOWER IN united states of america0.032258
LOWER IN dentition0.032258
mucus0.032258
oral cavity0.032258
australia0.032258
male0.032258
arm0.032258
amsterdam0.021505
brazil0.021505
belgium0.021505
nasal cavity0.021505
atlanta0.021505
cheek0.021505
india0.021505
LOWER IN adult0.021505
obsolete_juvenile stage0.021505
urban biome0.021505
LOWER IN skin0.021505
shanghai proper0.021505
age 7-14 years0.021505
rectal swab0.021505
LOWER IN central african republic0.021505
LOWER IN bangui0.021505
sichuan province0.021505
age0.021505
gay0.021505
LOWER IN heterosexual0.021505
LOWER IN msw0.021505
forearm0.021505
state of california0.021505
age < 3 years0.021505
finland0.021505
LOWER IN russia0.021505
LOWER IN supragingival plaque0.021505
mouth neoplasm0.021505
cancer0.021505
age 30-500.021505
age 60-790.021505
aphthous stomatitis0.010753
LOWER IN periodontitis0.010753
dental caries0.010753
LOWER IN tongue0.010753
induced sputum0.010753
sputum0.010753
LOWER IN oral wash0.010753
kingdom of the netherlands0.010753
nasopharynx0.010753
formula fed0.010753
LOWER IN breast fed0.010753
LOWER IN breast milk0.010753
diet0.010753
age < 1 year0.010753
nicotiana galuca0.010753
flower0.010753
nectar0.010753
israel0.010753
short bowel syndrome0.010753
lower labial mucosa0.010753
lip0.010753
Exp. ID User ID Description Date Region Flag Sequences
576amnon high in aphthous stomatitis compared to control in buccal mucosa mouth mucosa adult czech republic homo sapiens 2020-01-09v3No1 / 2
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
576amnondominant buccal mucosa, mouth mucosa, adult, czech republic, homo sapiens2020-01-09v3No1 / 14
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
576amnon high in mouth mucosa compared to tongue in adult czech republic homo sapiens 2020-01-09v3No1 / 22
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
576amnoncommon lower labial mucosa, mouth mucosa, lip, adult, czech republic, homo sapiens2020-01-09v3No1 / 66
576amnoncommon tongue, adult, czech republic, homo sapiens2020-01-09v3No1 / 67
576amnoncommon buccal mucosa, mouth mucosa, adult, czech republic, homo sapiens2020-01-09v3No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
563amnon high in hiv infection compared to control in homosexual msm male united states of america rectal swab feces homo sapiens 2019-11-18v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
563amnoncommon hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 111
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay msm homosexual compared to heterosexual msw in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 519
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org