Search result for sequence:
TAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.647651
adult0.437773
united states of america0.272652
saliva0.243709
child0.189815
feces0.179269
china0.169521
skin0.140164
infant0.138284
dentition0.128506
mouth0.119190
subgingival plaque0.102105
sweden0.085548
germany0.082730
mouth mucosa0.081772
control0.078162
canada0.076702
female0.076242
research facility0.076041
oral cavity0.075758
australia0.072874
state of new york0.067974
nasopharynx0.062302
supragingival plaque0.060156
state of california0.057996
tongue0.055336
pair of nares0.054711
province of ontario0.052632
epidermis0.051282
brazil0.049989
south korea0.049366
nasal cavity0.046786
periodontitis0.044271
supragingival dental plaque0.043956
oral wash0.041812
3-month-old human stage0.041609
poland0.041522
municipality of umea0.041096
kingdom of spain0.040909
city0.040782
lung0.039130
buccal mucosa0.039024
hospital0.038889
czech republic0.038647
2-year-old human stage0.037736
municipality of beijing0.037736
felis catus0.037736
dermal layer of tongue0.036300
breast milk0.036136
air0.035997
duodenum0.035685
larval stage0.035600
italy0.034815
LOWER IN control0.034483
subgingival dental plaque0.033333
costa rica0.032967
belgium0.032787
cat0.032345
perth0.030471
bolivia0.030471
commonwealth of pennsylvania0.030355
stomach0.030165
age 1-3 years0.029570
water0.028928
1-year-old human stage0.028314
age 25-45 years0.027972
7-year-old human stage0.027972
state of nebraska0.027778
rural community0.027586
kingdom of the netherlands0.027397
whole body0.026846
age0.025974
finland0.025260
recurrent otitis media0.025070
united kingdom0.024759
mucus0.024607
state of florida0.024161
sputum0.022535
bronchial epithelium0.022535
palatine tonsil0.022535
LOWER IN dentition0.022490
chronic periodontitis0.022472
ant0.022346
6-year-old human stage0.022346
8-year-old human stage0.022346
9-year-old human stage0.022346
10-year-old human stage0.022346
11-year-old human stage0.022346
state of michigan0.022099
beetle0.022099
africa0.021858
leaf0.021858
captive0.021467
bronchoalveolar lavage0.019724
chuquisaca department0.019608
third decade human stage0.019608
breast fed0.019608
macaca mulatta0.019608
greenhouse0.019608
LOWER IN caecum0.019449
Fraction of dbbact annotations with this term covered by the query
TermScore
lung0.900000
mouth mucosa0.888889
tongue0.875000
subgingival plaque0.857143
oral wash0.857143
sputum0.800000
buccal mucosa0.800000
bronchial epithelium0.800000
dermal layer of tongue0.800000
palatine tonsil0.800000
dentition0.782609
trachea0.750000
puerto rico0.750000
taiwan0.750000
saliva0.744186
finland0.714286
bronchoalveolar lavage0.714286
3-month-old human stage0.714286
oral cavity0.714286
hospital0.700000
supragingival plaque0.700000
LOWER IN dentition0.700000
breast milk0.666667
infant0.666667
age 5-10 years0.666667
skin of cheek0.666667
age 25-45 years0.666667
building0.666667
paranasal sinus0.666667
sinusoidal space0.666667
dust0.666667
nasal cavity mucosa0.666667
tracheal aspirate0.666667
chronic periodontitis0.666667
bronchus0.666667
7-year-old human stage0.666667
poland0.666667
formula fed0.666667
hong kong0.666667
tonsillitis0.666667
age < 3 years0.666667
endosphere0.666667
foot0.666667
atlanta0.666667
ice0.666667
republic of china0.666667
age 3 years0.666667
state of oklahoma0.666667
madrid0.666667
estonia0.666667
stream0.666667
pair of nares0.642857
mouth0.640000
nasal cavity0.636364
south korea0.615385
homo sapiens0.601533
nasopharynx0.600000
subgingival dental plaque0.600000
urine0.600000
axilla0.600000
tonsil0.600000
gill0.600000
LOWER IN subgingival plaque0.600000
air0.583333
czech republic0.571429
supragingival dental plaque0.571429
LOWER IN supragingival plaque0.571429
adult0.524390
aphis gossypii0.500000
cotton aphid0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age &gt;=7 days0.500000
child0.500000
perth0.500000
recurrent otitis media0.500000
middle ear rinse0.500000
LOWER IN periodontitis0.500000
LOWER IN chronic periodontitis0.500000
mild disease course0.500000
state of new hampshire0.500000
external acoustic meatus0.500000
ear canal0.500000
back0.500000
ant0.500000
bolivia0.500000
chuquisaca department0.500000
third decade human stage0.500000
upper eyelid0.500000
municipality of umea0.500000
2-days-old human0.500000
drosophila melanogaster0.500000
fruit fly0.500000
under-1-year-old human stage0.500000
age 8-12 years0.500000
LOWER IN lichen planus0.500000
jinan city prefecture0.500000
middle ear fluid0.500000
breast fed0.500000
baoding city prefecture0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.701429
adult0.375714
united states of america0.268571
feces0.155714
saliva0.145714
china0.141429
child0.117143
skin0.082857
infant0.077143
dentition0.070000
mouth0.065714
control0.054286
subgingival plaque0.054286
research facility0.051429
sweden0.047143
canada0.045714
female0.045714
germany0.045714
mouth mucosa0.042857
australia0.040000
oral cavity0.040000
state of new york0.037143
nasopharynx0.032857
state of california0.031429
supragingival plaque0.031429
province of ontario0.028571
epidermis0.028571
tongue0.028571
pair of nares0.028571
brazil0.027143
south korea0.025714
nasal cavity0.024286
periodontitis0.024286
supragingival dental plaque0.022857
kingdom of spain0.021429
LOWER IN control0.021429
municipality of umea0.021429
3-month-old human stage0.021429
city0.021429
oral wash0.021429
poland0.021429
2-year-old human stage0.020000
municipality of beijing0.020000
lung0.020000
felis catus0.020000
hospital0.020000
buccal mucosa0.020000
czech republic0.020000
breast milk0.018571
larval stage0.018571
air0.018571
italy0.018571
duodenum0.018571
dermal layer of tongue0.018571
subgingival dental plaque0.017143
costa rica0.017143
cat0.017143
belgium0.017143
age 1-3 years0.015714
perth0.015714
1-year-old human stage0.015714
stomach0.015714
bolivia0.015714
commonwealth of pennsylvania0.015714
water0.015714
whole body0.014286
age0.014286
kingdom of the netherlands0.014286
rural community0.014286
age 25-45 years0.014286
7-year-old human stage0.014286
state of nebraska0.014286
finland0.012857
recurrent otitis media0.012857
mucus0.012857
united kingdom0.012857
state of florida0.012857
ant0.011429
sputum0.011429
state of michigan0.011429
chronic periodontitis0.011429
bronchial epithelium0.011429
6-year-old human stage0.011429
8-year-old human stage0.011429
9-year-old human stage0.011429
10-year-old human stage0.011429
11-year-old human stage0.011429
captive0.011429
palatine tonsil0.011429
africa0.011429
beetle0.011429
LOWER IN dentition0.011429
leaf0.011429
bronchoalveolar lavage0.010000
crohn's disease0.010000
chuquisaca department0.010000
age 5-13 years0.010000
third decade human stage0.010000
breast fed0.010000
LOWER IN caecum0.010000
Exp. ID User ID Description Date Region Flag Sequences
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
771amnondominant body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 5
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 6
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 6
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
605amnoncommon external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 7
679amnondominant homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 7
717amnondominant homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 7
730amnon high in crohn's disease compared to control in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 7
284amnon high in age 2 months compared to 12-month-old human stage in feces homo sapiens female infant state of california 2018-01-27v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
517amnondominant homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 8
749amnondominant homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 8
565amnondominant skin, felis catus, cat, canada2019-11-21v3No1 / 8
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 8
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 9
244amnondominant digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 9
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 9
797amnoncommon feces, homo sapiens, infant, germany, age 1 month, breast fed2021-06-13v3No1 / 9
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
234amnoncommon homo sapiens, united states of america, lung2017-11-07v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
523amnondominant united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 10
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
749amnondominant homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 10
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 10
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
567amnoncommon homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 11
757amnon high in female compared to male in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 11
26amnondominant homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 12
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
567amnoncommon homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 12
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
806amnondominant homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 12
684amnondominant homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 12
35amnondominant homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
517amnondominant homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 13
567amnondominant homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
717amnondominant homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 13
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 13
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
158amnondominant united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
277amnondominant homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 14
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
546amnondominant homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 14
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
605amnondominant nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 14
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 14
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 14
684amnoncommon homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 14
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant air, french republic, autumn, cloud)2017-11-22v4No1 / 15
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 15
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
596amnondominant homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 15
613amnondominant research facility, aquarium, gastrointestinal system, fish, poland, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 15
685amnondominant homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 15
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 15
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
805amnondominant homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
806amnondominant homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 15
819amnoncommon homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 15
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 16
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 16
598amnondominant homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 16
652amnondominant homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 16
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 16
713amnon high in active disease compared to remission in feces homo sapiens crohn's disease 2028-05-21v3No1 / 16
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
277amnondominant homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 17
418amnondominant ocean, skeleton, coral, acropora hyacinthus2018-12-02v4No1 / 17
418amnondominant ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 17
460amnoncommon in occupied office air (common united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 17
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 17
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 18
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
715amnondominant homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 18
817amnondominant united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
519amnondominant homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 18
555amnondominant homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 18
716amnondominant homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 18
806amnondominant homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
532amnondominant feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 18
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
607amnoncommon homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 19
555amnondominant homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 19
678amnondominant homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 19
679amnondominant homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 19
704amnondominant homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 19
723amnondominant homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
806amnondominant homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 19
836amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, oral lichen planus, china, municipality of shanghai, gingival erosive oral lichen planus2021-09-11v3No1 / 19
105amnondominant homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
677amnondominant homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 20
703amnondominant homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
836amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of shanghai2021-09-11v3No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnondominant homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 21
278amnondominant homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon nectar, costa rica, flower, psiguria triphylla2019-03-08v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 21
576amnondominant homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 21
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 21
717amnondominant homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 21
726amnondominant homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 21
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
96amnondominant homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 22
158amnoncommon united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 22
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 22
425amnondominant homo sapiens, duodenum, child, africa, madagascar, stunted growth, antananarivo2018-12-08v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens adult czech republic 2020-01-09v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
658amnondominant homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
819amnoncommon homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
634amnondominant homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 23
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 23
704amnondominant homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 23
712amnondominant homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 23
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 24
260amnondominant homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 24
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
554amnondominant homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
717amnondominant homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 24
532amnoncommon feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
159amnon high in midgut compared to hindgut in australia siganidae rabbitfish 2017-07-06v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 25
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
607amnoncommon homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
717amnoncommon homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 25
723amnoncommon homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
565amnoncommon skin, felis catus, cat, canada2019-11-21v3No1 / 26
572amnondominant homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 26
104amnondominant homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 27
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
685amnoncommon homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 27
717amnoncommon homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 27
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens dentition adult brazil subgingival plaque mouth periodontitis 2018-09-13v4No1 / 28
817amnoncommon united states of america, research facility, lung, bronchoalveolar lavage, commonwealth of pennsylvania, captive, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
806amnoncommon homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v4No1 / 31
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
806amnoncommon homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 32
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
158amnoncommon united states of america, axilla, felis catus, cat2017-07-06v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
723amnon high in infant age 0-6 months compared to 2-5 year-old child stage in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
679amnoncommon homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 38
806amnoncommon homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 38
677amnoncommon homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 39
797amnon high in 3-month-old human stage compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm skin portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 41
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 43
696amnoncommon stomach, gastrointestinal system, malaysia, state of sabah, helicarionidae, land snail, kaliella scandens, kaliella2028-03-27v3No1 / 43
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 44
606amnoncommon homo sapiens, skin, adult, south africa, penis, male organism, male2020-04-15v3No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
572amnoncommon homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
89amnoncommon cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 48
546amnoncommon homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 48
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
730amnoncommon feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 51
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
416amnon high in fasting compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
771amnoncommon body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 55
817amnon high in saliva oral cavity oral wash cheek pouch compared to lung bronchoalveolar lavage in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 60
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
679amnoncommon homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
576amnoncommon homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 67
682amnoncommon city, air, kingdom of spain, madrid2028-03-04v3No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 71
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 75
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, stomach, biopsy, mucosa of stomach, helicobacter pylori infectious disease, south korea)2019-12-16v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 80
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
716amnoncommon homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 82
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, stomach, biopsy, south korea, mucosa of stomach)2019-12-16v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in respiratory airway north america megaptera novaeangliae humpback whale exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
703amnoncommon homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
836amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, oral lichen planus, china, municipality of shanghai, gingival erosive oral lichen planus2021-09-11v3No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
678amnoncommon homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 96
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in united states of america atlantic ocean state of florida south florida shark )2018-04-24v4No1 / 98
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 98
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
483amnoncommon united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 100
554amnoncommon homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 102
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 105
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth 0m in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
555amnoncommon homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
613amnoncommon research facility, aquarium, gastrointestinal system, poland, fish, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 116
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
323amnoncommon freq. in shark teeth (common united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 124
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
827sheryoHigher in soil depth of 275cm compared to soil depth of 60cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 20-120cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 129
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion modestum2019-04-18v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
615amnoncommon leaf, brazil, leaf surface, greenhouse, exosphere, campinas, saccharum, sugarcane2020-04-27v4No1 / 143
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
836amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of shanghai2021-09-11v3No1 / 155
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 157
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
159amnoncommon midgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 170
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 183
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
515amnoncommon river, poland, whole body, beetle, bembidion decorum, carnivorous beetle, raba river2019-04-18v4No1 / 198
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 206
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 240
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
558amnon high in summer compared to winter in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 274
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 291
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth 10 cm )2017-07-24v4No1 / 395
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
642amnon high in gill compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 434
577amnon high in high salinity hypersaline water depth 4-9m monimolimnion compared to low salinity depth 0-3m mixolimnion in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 1218
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth 200m, sediment depth 12-35cm2017-04-18v4No1 / 1659
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661

Problems / suggestions? Please email info AT dbbact DOT org