Search result for sequence:
TAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.796129
adult0.514049
feces0.492338
united states of america0.313959
saliva0.218392
china0.213730
child0.193119
infant0.178461
control0.115229
female0.103336
skin0.095771
germany0.085811
state of new york0.071856
sweden0.071627
research facility0.064541
state of california0.060255
city0.055776
tongue0.049514
hospital0.049166
obsolete_juvenile stage0.046531
oral cavity0.044091
italy0.043610
australia0.042777
mouth mucosa0.041949
mouth0.041280
south korea0.039457
kingdom of spain0.039308
mus musculus0.038185
india0.037083
foodon product type0.036474
canada0.035821
dermal layer of tongue0.034891
oral wash0.034800
nasopharynx0.034440
kingdom of the netherlands0.034440
municipality of umea0.034440
pair of nares0.033972
mouse0.033779
ulcerative colitis0.032515
buccal mucosa0.032449
obesity0.032405
crohn's disease0.032207
age0.031553
formula fed0.029888
3-month-old human stage0.029777
nasal cavity0.029579
soil0.029484
LOWER IN control0.029319
rural community0.027475
czech republic0.027138
united kingdom0.027114
kingdom of denmark0.027016
air0.024933
duodenum0.024896
cheese food product0.024845
breast milk0.024845
mucus0.024742
12-month-old human stage0.022627
amsterdam0.022585
LOWER IN dentition0.022560
colombia0.022542
diarrhea0.022416
poland0.022416
desert0.022250
dentition0.022098
hunter gatherer0.020109
taiwan0.020109
finland0.020095
2-year-old human stage0.020075
bolivia0.019975
fourth decade human stage0.019975
commonwealth of pennsylvania0.019778
leaf0.019584
canis lupus familiaris0.019116
jiangsu province0.018846
palatine tonsil0.017638
tanzania0.017625
1-month-old human stage0.017599
shanghai proper0.017599
sputum0.017573
2-5 year-old child stage0.017573
1-year-old human stage0.017560
state of michigan0.017553
breast fed0.017522
indonesia0.017522
municipality of yogyakarta0.017522
fifth decade human stage0.017522
africa0.017522
new york city0.017471
pregnancy0.017461
river0.017461
guangzhou city prefecture0.017445
belgium0.017420
cultivated environment0.017420
LOWER IN caecum0.017395
municipality of beijing0.017370
brazil0.017345
high bmi0.017332
israel0.017310
age 1 month0.017073
Fraction of dbbact annotations with this term covered by the query
TermScore
ulcerative colitis0.888889
infant0.875000
tongue0.875000
12-month-old human stage0.857143
homo sapiens0.835249
saliva0.813953
dermal layer of tongue0.800000
palatine tonsil0.800000
buccal mucosa0.800000
heterosexual0.800000
msw0.800000
adult0.774390
child0.750000
type i diabetes mellitus0.750000
tanzania0.750000
hunter gatherer0.750000
oropharynx0.750000
amsterdam0.750000
obesity0.750000
nigeria0.750000
graz city district0.750000
taiwan0.750000
obese body mass index status0.750000
type 2 diabetes mellitus0.750000
small village0.750000
oral wash0.714286
finland0.714286
LOWER IN supragingival plaque0.714286
hospital0.700000
rural community0.700000
LOWER IN dentition0.700000
first trimester0.666667
metabolic syndrome0.666667
LOWER IN mouth neoplasm0.666667
LOWER IN cancer0.666667
mouth mucosa0.666667
state of oklahoma0.666667
age 5-10 years0.666667
2-month-old human stage0.666667
diabetes mellitus0.666667
dust0.666667
floor0.666667
building0.666667
venezuela0.666667
amerindian0.666667
slovak republic0.666667
6-month-old human stage0.666667
2-year-old human stage0.666667
nasal cavity mucosa0.666667
bronchus0.666667
formula fed0.666667
1-month-old human stage0.666667
13-year-old human stage0.666667
14-year-old human stage0.666667
shanghai district0.666667
shanghai proper0.666667
hong kong0.666667
estonia0.666667
colombia0.666667
medellin metropolitan area0.666667
atlanta0.666667
adolescent stage0.666667
age < 3 years0.666667
10-15-years-old human0.666667
pancreatic cancer0.666667
republic of china0.666667
skin of cheek0.666667
overweight body mass index status0.666667
LOWER IN breast fed0.666667
nectar0.666667
dorsum0.666667
salamandra salamandra0.666667
stream0.666667
LOWER IN sinusitis0.666667
athlete0.666667
young adult stage0.666667
madagascar0.666667
newt0.666667
central african republic0.666667
age 5-13 years0.666667
LOWER IN nasopharynx0.666667
homosexual0.666667
msm0.666667
rana catesbeiana0.666667
bullfrog0.666667
arm0.666667
toronto0.666667
LOWER IN stem0.666667
india0.625000
south korea0.615385
obsolete_juvenile stage0.600000
sputum0.600000
state of new york0.600000
2-5 year-old child stage0.600000
flower0.600000
jejunum0.600000
LOWER IN subgingival plaque0.600000
parkinson's disease0.600000
LOWER IN supragingival dental plaque0.600000
crohn's disease0.583333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.760510
feces0.463694
adult0.384713
united states of america0.273885
china0.165605
saliva0.126115
child0.110828
infant0.099363
control0.073885
female0.059873
skin0.052229
germany0.047134
research facility0.042038
sweden0.039490
state of new york0.038217
state of california0.033121
city0.029299
tongue0.025478
hospital0.025478
obsolete_juvenile stage0.024204
italy0.022930
oral cavity0.022930
australia0.022930
mouth mucosa0.021656
mouth0.021656
mus musculus0.021656
south korea0.020382
kingdom of spain0.020382
foodon product type0.019108
india0.019108
mouse0.019108
canada0.019108
soil0.019108
nasopharynx0.017834
kingdom of the netherlands0.017834
dermal layer of tongue0.017834
LOWER IN control0.017834
municipality of umea0.017834
oral wash0.017834
pair of nares0.017834
age0.016561
ulcerative colitis0.016561
buccal mucosa0.016561
obesity0.016561
crohn's disease0.016561
nasal cavity0.015287
3-month-old human stage0.015287
formula fed0.015287
kingdom of denmark0.014013
czech republic0.014013
united kingdom0.014013
rural community0.014013
cheese food product0.012739
breast milk0.012739
duodenum0.012739
mucus0.012739
air0.012739
diarrhea0.011465
12-month-old human stage0.011465
dentition0.011465
amsterdam0.011465
poland0.011465
colombia0.011465
LOWER IN dentition0.011465
desert0.011465
commonwealth of pennsylvania0.010191
hunter gatherer0.010191
2-year-old human stage0.010191
bolivia0.010191
finland0.010191
canis lupus familiaris0.010191
fourth decade human stage0.010191
jiangsu province0.010191
taiwan0.010191
leaf0.010191
pregnancy0.008917
palatine tonsil0.008917
age 1 month0.008917
breast fed0.008917
sputum0.008917
brazil0.008917
tanzania0.008917
municipality of beijing0.008917
LOWER IN caecum0.008917
2-5 year-old child stage0.008917
1-year-old human stage0.008917
new york city0.008917
state of michigan0.008917
1-month-old human stage0.008917
shanghai proper0.008917
high bmi0.008917
indonesia0.008917
municipality of yogyakarta0.008917
belgium0.008917
guangzhou city prefecture0.008917
fifth decade human stage0.008917
wild0.008917
israel0.008917
male0.008917
africa0.008917
Exp. ID User ID Description Date Region Flag Sequences
74amnondominant united states of america, caerphilly cheese, curd, foodon product type, cheese food product2017-02-27v4No1 / 2
348amnondominant italy, yogurt food product, food (fermented)2018-07-16v4No1 / 2
455amnonColonizes gut as well as saliva (other feces, homo sapiens, saliva)2019-11-25v4No1 / 2
74amnondominant united states of america, string cheese, foodon product type, cheese food product2017-02-27v4No1 / 3
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to starch diet resistant starch type 4 diet in feces homo sapiens united states of america metabolic syndrome x metabolic syndrome )2019-02-24v4No1 / 3
74amnoncommon united states of america, string cheese, foodon product type, cheese food product2017-02-27v4No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v4No1 / 6
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 6
242amnonlower in native-americans compared to non native-american ( high in american compared to cheyenne native american arapaho in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 6
74amnondominant united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
74amnondominant united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
679amnondominant homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 7
74amnoncommon united states of america, caerphilly cheese, curd, foodon product type, cheese food product2017-02-27v4No1 / 8
74amnoncommon united states of america, pisum sativum, foodon product type2017-02-27v4No1 / 8
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 8
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
332amnondominant homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
773amnonhigh in iga bound bacteria compared to non iga bound bacteria ( high in iga positive fraction compared to iga negative fraction in homo sapiens adult palatine tonsil japan tonsillectomy )2021-04-23v4No1 / 9
797amnoncommon feces, homo sapiens, infant, germany, age 1 month, breast fed2021-06-13v3No1 / 9
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
621amnondominant body proper, australia, whole body, tick, ixodes ornithorhynchi2020-05-07v1No1 / 10
74amnondominant united states of america, rind, caerphilly cheese, foodon product type, cheese food product2017-02-27v4No1 / 11
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
391amnondominant feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 11
533amnoncommon homo sapiens, nasopharynx, infant, fiji, 12-month-old human stage2019-07-22v4No1 / 11
757amnon high in female compared to male in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 11
74amnoncommon united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 12
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
806amnondominant homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 12
35amnondominant homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 13
48amnondominant homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v4No1 / 13
199amnonhigh freq. on shower wall tile (dominant united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 13
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
546amnondominant homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 14
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 14
797amnon high in age 1 month compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 14
684amnoncommon homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 14
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 15
339amnondominant feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
596amnondominant homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 15
685amnondominant homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 15
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnondominant feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, age 1 month, formula fed2021-06-13v3No1 / 15
805amnondominant homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
806amnondominant homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 15
74amnoncommon united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 16
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
598amnondominant homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 16
652amnondominant homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 16
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
199amnonhigh freq. in kitchen sink (dominant united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 17
418amnondominant ocean, skeleton, coral, acropora hyacinthus2018-12-02v4No1 / 17
418amnondominant ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
730amnondominant feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 18
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
488amnondominant feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
555amnondominant homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 18
716amnondominant homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
806amnondominant homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
532amnondominant feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 18
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
449amnondominant feces, homo sapiens, colombia2019-01-09v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnondominant feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 19
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
723amnondominant homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
797amnondominant feces, homo sapiens, infant, germany, age 1 month, formula fed2021-06-13v3No1 / 19
806amnondominant homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
238amnondominant feces, homo sapiens, colombia2017-11-07v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v4No1 / 20
677amnondominant homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, age 1 month, breast fed2021-06-13v3No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
730amnondominant feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 20
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 21
576amnondominant homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 21
593amnondominant feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 21
726amnondominant homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 21
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
797amnon high in age 1 month compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
74amnoncommon united states of america, capsicum annuum, foodon product type2017-02-27v4No1 / 23
74amnoncommon united states of america, prosciutto, foodon product type2017-02-27v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
830amnondominant feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 23
832amnondominant feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 23
634amnondominant homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 23
704amnondominant homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
532amnoncommon feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
723amnoncommon homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
74amnoncommon united states of america, rind, caerphilly cheese, foodon product type, cheese food product2017-02-27v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
572amnondominant homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
685amnoncommon homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 27
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
397amnoncommon digestive system, intestine, panama, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
806amnoncommon homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 31
806amnoncommon homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 35
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
679amnoncommon homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 38
806amnoncommon homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
677amnoncommon homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 39
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
399amnon high in ulcerative colitis compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 47
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
830amnoncommon feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 47
572amnoncommon homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
546amnoncommon homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
149amnoncommon mucus, larval stage, amphibian larval stage, skin, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 49
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
576amnon high in tongue compared to mouth mucosa in homo sapiens adult czech republic 2020-01-09v3No1 / 50
834amnoncommon feces, homo sapiens, adult, japan2021-09-11v1No1 / 50
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
730amnoncommon feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in feces homo sapiens infant india )2016-12-19v4No1 / 56
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
806amnon high in oral cavity oral wash compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 58
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 60
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
679amnoncommon homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 64
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to cheek dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 65
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
576amnoncommon homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 67
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 69
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
99amnoncommon united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 74
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 75
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens nasopharynx infant australia )2017-04-16v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
716amnoncommon homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 82
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to late timepoint fresh food spoilage in foodon product type china )2018-01-09v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
458amnonpositively correlated with age ( high in age age 24 weeks compared to age 3 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 99
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 102
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
213amnoncommon homo sapiens, vagina, south africa2017-10-22v4No1 / 103
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 105
377amnoncommon skin, germany, salamandra salamandra, salamander2018-09-12v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth 0m in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
214amnon high in c57bl/6j compared to strain s129 in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 113
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 124
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
374amnoncommon skin, costa rica, frog, amphibia, craugastor fitzingeri, common rain frog2018-09-09v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
833amnoncommon feces, homo sapiens, adult, slovak republic, age 60-65 years, normal exercise2021-09-11v1No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, athlete, age 60-65 years, high exercise2021-09-11v1No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth 10 cm2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
499amnoncommon digestive system, pond, intestine, brazil, fish, astyanax paranae, astyanax2019-03-05v4No1 / 273
558amnon high in summer compared to winter in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 274
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 291
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
499amnoncommon digestive system, pond, intestine, poecilia reticulata, brazil, fish, guppy2019-03-05v4No1 / 308
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
782amnon high in skin compared to gill in fish farm portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 325
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
792amnoncommon desert, rhizosphere, depth 0.5m, china, minqin county, sand, nitraria tangutorum, ph 92021-06-07v4No1 / 352
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth 10 cm )2017-07-24v4No1 / 395
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth 0.5m china minqin county sand ph 9 2021-06-07v4No1 / 432
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
792amnoncommon desert, rhizosphere, depth 0.5m, china, minqin county, sand, haloxylon ammodendron, ph 92021-06-07v4No1 / 443
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 558
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
792amnoncommon desert, soil, depth 0.5m, china, minqin county, sand, ph 92021-06-07v4No1 / 595
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil water soilwater in canada province of quebec )2017-12-11v4No1 / 610
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596

Problems / suggestions? Please email info AT dbbact DOT org