Search result for sequence:
TGAGGAATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTATAGGGATAAACCTTTCCACGTGTGGAAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACT
common ontology terms
term enrichment score
TermScore
medicago sativa0.600000
alfalfa sprouts0.600000
food product type0.600000
producer c10.500000
eastern gray squirrel0.333333
sciurus carolinensis0.333333
canada0.333333
producer c20.333333
israel0.150000
skin0.068966
Fraction of dbbact annotations with this term covered by the query
TermScore
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
canada0.500000
producer c20.500000
israel0.083333
skin0.040000
Fraction of annotations for the query sequences containing the term
TermScore
medicago sativa0.750000
alfalfa sprouts0.750000
food product type0.750000
israel0.750000
producer c10.500000
eastern gray squirrel0.250000
sciurus carolinensis0.250000
canada0.250000
skin0.250000
producer c20.250000

Problems / suggestions? Please email info AT dbbact DOT org