Search result for sequence:
TGAGGAATATTGGTCAATGGACGCGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAGTGGTCCACGTGTGGATTTTTGTATGTACCATATGAATAAGGATCGGCTAACT
common ontology terms
term enrichment score
TermScore
homo sapiens0.576091
feces0.498962
adult0.407459
united states of america0.220723
child0.161725
china0.140917
control0.130486
city0.113422
jiangsu province0.097561
obsolete_juvenile stage0.095238
kingdom of spain0.094118
infant0.080831
caecum0.066298
state of california0.065268
heterosexual0.064655
msw0.064655
czech republic0.062630
female0.061584
israel0.060729
rat0.059524
research facility0.055797
LOWER IN control0.054369
rex rabbit0.051948
age 5-13 years0.051948
LOWER IN ulcerative colitis0.051613
india0.051613
oryctolagus cuniculus0.051282
rural community0.050847
ileum0.050420
sichuan province0.050000
rectum0.050000
united kingdom0.050000
state of colorado0.049383
kingdom of norway0.048780
colon0.046154
LOWER IN gay0.039474
LOWER IN msm0.039474
LOWER IN homosexual0.039474
wistar rat0.039344
gallbladder0.038961
bile0.038961
cholelithiasis0.038961
oslo0.038961
LOWER IN child0.038961
biopsy0.038217
kingdom of denmark0.038217
commonwealth of pennsylvania0.038217
LOWER IN crohn's disease0.038217
rattus0.038217
water0.037975
age0.035928
australia0.035191
fresh water0.034286
male0.026490
metabolic syndrome0.026490
mongolian sheep0.026316
age one year0.026316
age 30-400.026316
taiwan0.026316
taipei city0.026316
low anterior resection0.026316
jordan0.026316
quito0.026316
age 13-140.026316
denver0.026316
lima0.026316
shantytown0.026316
age 60-790.026316
age 30-500.026316
age >940.026316
glasgow0.026316
age 130.026316
LOWER IN small village0.026316
LOWER IN age < 1 year0.026316
age 50-60 years0.026316
nanning city prefecture0.026316
dahl salt-sensitive0.026316
estuary0.026316
estuary water0.026316
salinity <5 ppt0.026316
bilbao0.026316
africa0.026316
chuquisaca department0.026316
LOWER IN rural community0.026144
age 2 months0.025974
state of oklahoma0.025974
LOWER IN mouth mucosa0.025974
LOWER IN hiv infection0.025806
left colon0.025641
biopsy site0.025641
ecuador0.025641
juvenile organism0.025641
LOWER IN duodenum0.025641
bolivia0.025641
commonwealth of virginia0.025316
ovis aries0.025000
hospital0.025000
river0.025000
diarrhea0.024691
pregnancy0.024691
Fraction of dbbact annotations with this term covered by the query
TermScore
heterosexual0.750000
msw0.750000
LOWER IN gay0.750000
LOWER IN msm0.750000
LOWER IN homosexual0.750000
rex rabbit0.666667
age 5-13 years0.666667
male0.666667
metabolic syndrome0.666667
wistar rat0.666667
LOWER IN ulcerative colitis0.571429
india0.571429
oryctolagus cuniculus0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
mongolian sheep0.500000
cecum0.500000
sigmoid colon0.500000
children0.500000
equine grass sickness0.500000
anorexia nervosa0.500000
age one year0.500000
oslo0.500000
age 30-400.500000
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
insomnia0.500000
jordan0.500000
quito0.500000
jiangsu province0.500000
age 13-140.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
rectal swab0.500000
age 17-290.500000
denver0.500000
age 200.500000
metabolic syndrome x0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN child0.500000
LOWER IN inflammatory bowel disease0.500000
aardvark0.500000
orycteropus afer0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
cron diet0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
toronto0.500000
LOWER IN plant diet0.500000
dnbs induced colitis0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
new delhi0.500000
spondyloarthritis0.500000
spondylitis0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
canada0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
dahl salt-sensitive0.500000
salt rich diet0.500000
salt0.500000
age 1-20.500000
LOWER IN age 0-10.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.844595
feces0.844595
adult0.398649
united states of america0.310811
china0.168919
control0.148649
child0.101351
city0.067568
research facility0.060811
LOWER IN control0.054054
kingdom of spain0.054054
obsolete_juvenile stage0.054054
jiangsu province0.054054
infant0.047297
female0.047297
state of california0.047297
caecum0.040541
israel0.033784
heterosexual0.033784
msw0.033784
czech republic0.033784
rat0.033784
oryctolagus cuniculus0.027027
rex rabbit0.027027
sichuan province0.027027
rectum0.027027
ileum0.027027
colon0.027027
united kingdom0.027027
kingdom of norway0.027027
age 5-13 years0.027027
LOWER IN ulcerative colitis0.027027
state of colorado0.027027
rural community0.027027
india0.027027
water0.027027
gallbladder0.020270
bile0.020270
cholelithiasis0.020270
biopsy0.020270
kingdom of denmark0.020270
australia0.020270
oslo0.020270
commonwealth of pennsylvania0.020270
LOWER IN gay0.020270
LOWER IN msm0.020270
LOWER IN homosexual0.020270
LOWER IN child0.020270
LOWER IN crohn's disease0.020270
rattus0.020270
wistar rat0.020270
age0.020270
fresh water0.020270
antibiotic0.013514
mongolian sheep0.013514
ovis aries0.013514
left colon0.013514
biopsy site0.013514
commonwealth of virginia0.013514
age one year0.013514
age 2 months0.013514
hospital0.013514
diarrhea0.013514
age 30-400.013514
taiwan0.013514
taipei city0.013514
low anterior resection0.013514
brazil0.013514
jordan0.013514
ecuador0.013514
quito0.013514
age 13-140.013514
zoological garden0.013514
LOWER IN hiv infection0.013514
male0.013514
denver0.013514
metabolic syndrome0.013514
pregnancy0.013514
belgium0.013514
lima0.013514
shantytown0.013514
state of oklahoma0.013514
age 60-790.013514
age 30-500.013514
age >940.013514
glasgow0.013514
age 130.013514
juvenile organism0.013514
LOWER IN small village0.013514
LOWER IN rural community0.013514
LOWER IN age < 1 year0.013514
LOWER IN duodenum0.013514
age 50-60 years0.013514
nanning city prefecture0.013514
rattus norvegicus0.013514
dahl salt-sensitive0.013514
estuary0.013514
estuary water0.013514
salinity <5 ppt0.013514
bilbao0.013514
Exp. ID User ID Description Date Region Flag Sequences
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 5
526amnonhigh freq in bile of Cholelithiasis patients (highfreq homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
111amnonhighfreq mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (highfreq rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
448amnonhighfreq equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
390amnonhighfreq homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
390amnonhighfreq homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (highfreq homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
566amnon high in insomnia compared to control in adult china feces homo sapiens 2019-11-24v4No1 / 23
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnonhighfreq age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 28
438amnonhighfreq homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
563amnon high in control compared to hiv infection in homosexual msm male united states of america rectal swab feces homo sapiens 2019-11-18v4No1 / 58
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
580amnoncommon third trimester, pregnancy, female, adult, israel, feces, homo sapiens2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon first trimester, pregnancy, female, adult, israel, feces, homo sapiens2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to msm gay homosexual in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 220
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 755
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org