Search result for sequence:
TGAGGAATATTGGTCAATGGGCGCAAGCCTGAACCAGCCATGCCGCGTGCAGGATGACGGTCCTATGGATTGTAAACTGCTTTTGTACGGGAAGAAACACTGATTCGTGAATCAGCTTGACGGTACCGTAAGAATAAGGATCGGCTAACT
common ontology terms
term enrichment score
TermScore
cultivated environment0.250000
food product type0.200000
orchard0.200000
populus0.200000
citrus0.181818
soybean0.181818
LOWER IN root0.181818
rhizosphere0.171429
glycine max0.166667
skin0.163265
depth 0-20cm0.153846
state of tennessee0.153846
tree0.153846
producer c10.142857
medicago sativa0.142857
alfalfa sprouts0.142857
plant0.125000
LOWER IN soil0.114286
soil0.114286
israel0.100000
producer c20.076923
mung bean sprouts0.076923
vigna radiata0.076923
rhinella icterica0.076923
yellow cururu toad0.076923
mud0.076923
fermentation pit mud0.076923
ginger0.076923
state of rhode island0.076923
southern united states0.076923
pantherophis obsoletus0.076923
black rat snake0.076923
arboreal snake0.076923
LOWER IN day 10.076923
day 120.076923
stover ammendment soil0.076923
coarse-loamy soil0.076923
mediterranean0.076923
greenhouse0.076923
chlorophytum comosum0.076923
zoo0.076923
andrias japonicus0.076923
japanese giant salamander0.076923
LOWER IN area designated as a nature reserve0.076923
LOWER IN digestive system0.076923
LOWER IN frog0.076923
LOWER IN quasipaa spinosa0.076923
LOWER IN giant spiny frog0.076923
ensete ventricosum0.076923
ethiopian banana0.076923
days 30-600.076923
anaerobic fermentation0.076923
LOWER IN days 1-150.076923
LOWER IN aerobic fermentation0.076923
reunion island0.076923
depth 0-30cm0.076923
silt loam0.076923
bulk soil0.076923
brassicaceae0.076923
boechera stricta0.076923
state of idaho0.076923
LOWER IN root structure0.076923
toad0.074074
salamandra salamandra0.074074
salamander0.074074
snake0.074074
new york0.074074
semi-arid0.074074
LOWER IN subtropical0.074074
jiangxi province0.074074
wheat0.074074
ph 50.071429
ph 60.071429
depth 0-5cm0.071429
LOWER IN pond0.071429
ethiopia0.071429
LOWER IN early timepoint0.071429
late timepoint0.071429
triticum aestivum0.071429
china0.070796
foodon product type0.068966
austria0.066667
hunan province0.066667
LOWER IN leaf0.066667
zoological garden0.062500
food (fermented)0.062500
germany0.057143
japan0.057143
kingdom of spain0.055556
root0.054054
brazil0.052632
LOWER IN colon0.052632
united states of america0.047814
fresh water0.047619
leaf0.046512
water0.027397
adult0.017391
Fraction of dbbact annotations with this term covered by the query
TermScore
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
producer c20.500000
mung bean sprouts0.500000
vigna radiata0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
mud0.500000
fermentation pit mud0.500000
ginger0.500000
state of rhode island0.500000
southern united states0.500000
pantherophis obsoletus0.500000
black rat snake0.500000
arboreal snake0.500000
LOWER IN day 10.500000
day 120.500000
stover ammendment soil0.500000
coarse-loamy soil0.500000
orchard0.500000
mediterranean0.500000
greenhouse0.500000
chlorophytum comosum0.500000
zoo0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN area designated as a nature reserve0.500000
LOWER IN digestive system0.500000
LOWER IN frog0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
LOWER IN days 1-150.500000
LOWER IN aerobic fermentation0.500000
reunion island0.500000
populus0.500000
depth 0-30cm0.500000
silt loam0.500000
bulk soil0.500000
brassicaceae0.500000
boechera stricta0.500000
state of idaho0.500000
LOWER IN root structure0.500000
toad0.333333
salamandra salamandra0.333333
salamander0.333333
snake0.333333
new york0.333333
citrus0.333333
semi-arid0.333333
LOWER IN subtropical0.333333
jiangxi province0.333333
soybean0.333333
wheat0.333333
LOWER IN root0.333333
ph 50.250000
ph 60.250000
depth 0-5cm0.250000
cultivated environment0.250000
plant0.250000
LOWER IN pond0.250000
ethiopia0.250000
LOWER IN early timepoint0.250000
late timepoint0.250000
glycine max0.250000
triticum aestivum0.250000
foodon product type0.200000
depth 0-20cm0.200000
state of tennessee0.200000
tree0.200000
LOWER IN soil0.181818
austria0.166667
hunan province0.166667
LOWER IN leaf0.166667
skin0.160000
zoological garden0.125000
food (fermented)0.125000
rhizosphere0.111111
germany0.090909
japan0.090909
israel0.083333
kingdom of spain0.083333
root0.076923
soil0.074074
brazil0.071429
LOWER IN colon0.071429
fresh water0.055556
leaf0.052632
china0.041237
united states of america0.026042
water0.020408
adult0.010989
Fraction of annotations for the query sequences containing the term
TermScore
rhizosphere0.375000
united states of america0.291667
china0.250000
soil0.250000
cultivated environment0.250000
skin0.166667
food product type0.125000
israel0.125000
citrus0.125000
orchard0.125000
depth 0-20cm0.125000
glycine max0.125000
soybean0.125000
state of tennessee0.125000
populus0.125000
tree0.125000
LOWER IN root0.125000
producer c10.083333
medicago sativa0.083333
alfalfa sprouts0.083333
plant0.083333
LOWER IN soil0.083333
producer c20.041667
mung bean sprouts0.041667
vigna radiata0.041667
brazil0.041667
adult0.041667
rhinella icterica0.041667
toad0.041667
yellow cururu toad0.041667
mud0.041667
ph 50.041667
fermentation pit mud0.041667
salamandra salamandra0.041667
salamander0.041667
germany0.041667
ginger0.041667
state of rhode island0.041667
foodon product type0.041667
snake0.041667
southern united states0.041667
pantherophis obsoletus0.041667
black rat snake0.041667
arboreal snake0.041667
LOWER IN day 10.041667
day 120.041667
stover ammendment soil0.041667
ph 60.041667
coarse-loamy soil0.041667
new york0.041667
depth 0-5cm0.041667
mediterranean0.041667
semi-arid0.041667
LOWER IN subtropical0.041667
leaf0.041667
austria0.041667
greenhouse0.041667
chlorophytum comosum0.041667
zoological garden0.041667
zoo0.041667
LOWER IN pond0.041667
andrias japonicus0.041667
japanese giant salamander0.041667
LOWER IN area designated as a nature reserve0.041667
japan0.041667
water0.041667
fresh water0.041667
LOWER IN digestive system0.041667
LOWER IN colon0.041667
LOWER IN frog0.041667
LOWER IN quasipaa spinosa0.041667
LOWER IN giant spiny frog0.041667
jiangxi province0.041667
hunan province0.041667
ethiopia0.041667
ensete ventricosum0.041667
ethiopian banana0.041667
days 30-600.041667
anaerobic fermentation0.041667
LOWER IN days 1-150.041667
LOWER IN aerobic fermentation0.041667
LOWER IN early timepoint0.041667
late timepoint0.041667
food (fermented)0.041667
reunion island0.041667
depth 0-30cm0.041667
silt loam0.041667
kingdom of spain0.041667
triticum aestivum0.041667
wheat0.041667
bulk soil0.041667
brassicaceae0.041667
boechera stricta0.041667
state of idaho0.041667
LOWER IN leaf0.041667
root0.041667
LOWER IN root structure0.041667
Exp. ID User ID Description Date Region Flag Sequences
587amnondominant producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 12
587amnoncommon producer c2, mung bean sprouts, vigna radiata, food product type, israel2020-02-10v3No1 / 67
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
587amnoncommon producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 106
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in stover ammendment soil ph 6 coarse-loamy soil new york united states of america depth 0-5cm soil )2020-03-27v4No1 / 196
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 264
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 510
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org