Search result for sequence:
TGAGGAATTTTCGTCAATGGGGGCAACCCTGAACGAGCAACGCCGCGTGCAGGAAGAAGGTTTTCGGATCGTAAACTGCTTTTCTCGGGGAAGAGAACGGACGGTACCCGAGGAATCAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT
common ontology terms
term enrichment score
TermScore
elevation 2000-3000m0.666667
siliceous parent material0.600000
canton of graubunden0.500000
mountain0.500000
rhone river valley0.500000
ph 4-60.400000
calcareous parent material0.333333
ph 4.5-70.333333
switzerland0.285714
ph 7-80.222222
depth 0-10cm0.222222
soil0.036364
Fraction of dbbact annotations with this term covered by the query
TermScore
calcareous parent material0.500000
canton of graubunden0.500000
elevation 2000-3000m0.500000
ph 4.5-70.500000
siliceous parent material0.500000
rhone river valley0.500000
mountain0.333333
ph 4-60.333333
ph 7-80.200000
switzerland0.166667
depth 0-10cm0.125000
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
elevation 2000-3000m1.000000
depth 0-10cm1.000000
switzerland1.000000
mountain1.000000
soil1.000000
siliceous parent material0.750000
canton of graubunden0.500000
rhone river valley0.500000
ph 4-60.500000
ph 7-80.250000
calcareous parent material0.250000
ph 4.5-70.250000

Problems / suggestions? Please email info AT dbbact DOT org