Search result for sequence:
TGATAAACCTTTAGCAATAAACCAAAGTTTAACTAAGCCATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAACCGGCATAAAGAGTGTTTTAGATCAATTCCCCTCAATAAA
common ontology terms
term enrichment score
TermScore
mucosa of stomach0.571429
helicobacter pylori infectious disease0.400000
romania0.400000
ursu lake0.400000
lake water0.333333
south korea0.266667
biopsy0.266667
depth 0-3m0.250000
mixolimnion0.250000
depth 4-9m0.250000
hypersaline water0.250000
monimolimnion0.250000
low salinity0.222222
high salinity0.222222
lake0.200000
stomach0.129032
water0.036364
homo sapiens0.010230
Fraction of dbbact annotations with this term covered by the query
TermScore
mucosa of stomach0.500000
helicobacter pylori infectious disease0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
depth 4-9m0.500000
hypersaline water0.500000
monimolimnion0.500000
lake water0.333333
low salinity0.333333
high salinity0.333333
south korea0.166667
biopsy0.166667
lake0.142857
stomach0.071429
water0.019231
homo sapiens0.005155
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.666667
south korea0.666667
mucosa of stomach0.666667
stomach0.666667
biopsy0.666667
helicobacter pylori infectious disease0.333333
lake0.333333
romania0.333333
ursu lake0.333333
water0.333333
lake water0.333333
depth 0-3m0.166667
mixolimnion0.166667
low salinity0.166667
depth 4-9m0.166667
high salinity0.166667
hypersaline water0.166667
monimolimnion0.166667

Problems / suggestions? Please email info AT dbbact DOT org