Search result for sequence:
TGATAAACCTTTAGCAATAAACCAAAGTTTAAGCCATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAACCGGCATAAAGAGTGTTTTAGATCAATTCCCCTCAATAAAGCTA
common ontology terms
term enrichment score
TermScore
mucosa of stomach0.666667
helicobacter pylori infectious disease0.500000
south korea0.333333
biopsy0.285714
stomach0.133333
homo sapiens0.011905
Fraction of dbbact annotations with this term covered by the query
TermScore
helicobacter pylori infectious disease0.500000
mucosa of stomach0.500000
south korea0.200000
biopsy0.166667
stomach0.071429
homo sapiens0.005988
Fraction of annotations for the query sequences containing the term
TermScore
biopsy1.000000
stomach1.000000
mucosa of stomach1.000000
south korea1.000000
homo sapiens1.000000
helicobacter pylori infectious disease0.500000

Problems / suggestions? Please email info AT dbbact DOT org