Search result for sequence:
TGATAAACCTTTAGCAATAAACCAAAGTTTAAGCCATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAACCGGCATAAAGAGTGTTTTAGATCAATTCCCCTCAATAAAGCTA
common ontology terms
term enrichment score
TermScore
mucosa of stomach0.571429
helicobacter pylori infectious disease0.400000
perth0.400000
recurrent otitis media0.400000
middle ear fluid0.400000
LOWER IN middle ear rinse0.400000
age 1-3 years0.333333
middle ear0.333333
south korea0.266667
biopsy0.266667
stomach0.129032
australia0.090909
child0.074074
homo sapiens0.010230
Fraction of dbbact annotations with this term covered by the query
TermScore
mucosa of stomach0.500000
helicobacter pylori infectious disease0.500000
perth0.500000
recurrent otitis media0.500000
middle ear fluid0.500000
LOWER IN middle ear rinse0.500000
age 1-3 years0.333333
middle ear0.333333
south korea0.166667
biopsy0.166667
stomach0.071429
australia0.052632
child0.041667
homo sapiens0.005155
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.666667
south korea0.666667
mucosa of stomach0.666667
stomach0.666667
biopsy0.666667
helicobacter pylori infectious disease0.333333
australia0.333333
child0.333333
age 1-3 years0.333333
perth0.333333
recurrent otitis media0.333333
middle ear0.333333
middle ear fluid0.333333
LOWER IN middle ear rinse0.333333

Problems / suggestions? Please email info AT dbbact DOT org