Search result for sequence:
TGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGCTCATGGTCAAGCCGCGACATTGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG
common ontology terms
term enrichment score
TermScore
homo sapiens0.606675
saliva0.336264
adult0.298602
feces0.224027
mouth0.184032
united states of america0.180113
child0.172152
infant0.164835
dentition0.103279
city0.096983
bronchial epithelium0.096970
china0.092042
subgingival plaque0.084000
bolivia0.082840
obsolete_juvenile stage0.082840
skin0.076018
india0.073439
oral wash0.073171
duodenum0.069364
lung0.061538
colombia0.061224
africa0.060606
rural community0.060000
LOWER IN control0.059975
LOWER IN feces0.057554
jiangsu province0.055556
state of california0.053571
mouth mucosa0.049896
bronchus0.049689
atlanta0.049689
age < 3 years0.049689
venezuela0.049689
amerindian0.049689
oral cavity0.049080
hunter gatherer0.049080
russia0.048485
control0.045652
sputum0.037618
state of oklahoma0.037618
bronchial brush0.037267
san diego0.037267
canada0.037267
atherosclerosis0.037267
bronchoalveolar lavage0.037267
chuquisaca department0.037267
age 8-120.037267
finland0.037037
state of texas0.036585
mouth neoplasm0.036585
cancer0.036585
age 5-13 years0.036585
kingdom of denmark0.036585
brazil0.035503
italy0.035294
pair of nares0.034985
LOWER IN adult0.034884
diet0.033520
age0.032698
female0.029126
trachea0.025316
state of new york0.025316
arm0.025316
LOWER IN left colon0.025157
LOWER IN sputum0.025157
LOWER IN induced sputum0.025157
induced sputum0.025157
periodontal pocket0.025157
age<17 years0.025157
uganda0.025157
pneumonia0.025157
LOWER IN biopsy0.025157
LOWER IN biopsy site0.025157
age 3-60.025157
stunted growth0.025157
age 30-500.025157
new delhi0.025157
age >940.025157
antananarivo0.025157
madagascar0.025157
age 13-140.025157
age 130.025157
glasgow0.025157
small village0.025157
male0.025000
south korea0.025000
aphthous stomatitis0.024845
sinusoidal space0.024845
paranasal sinus0.024845
sichuan province0.024845
south america0.024845
ulcerative colitis0.024691
french republic0.024691
mucosa0.024540
small intestine0.024540
juvenile organism0.024540
wastewater treatment plant0.024540
crohn's disease0.024390
nasal cavity0.024390
tongue0.024242
LOWER IN female0.024242
Fraction of dbbact annotations with this term covered by the query
TermScore
bronchial epithelium0.800000
mouth mucosa0.750000
saliva0.720000
india0.714286
oral wash0.666667
sputum0.666667
bronchus0.666667
lung0.666667
trachea0.666667
atlanta0.666667
state of oklahoma0.666667
state of new york0.666667
age < 3 years0.666667
venezuela0.666667
amerindian0.666667
arm0.666667
subgingival plaque0.600000
colombia0.600000
mouth0.571429
infant0.555556
LOWER IN left colon0.500000
vellore district0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
lower labial mucosa0.500000
induced sputum0.500000
age 12-23 years0.500000
induced periodontitis0.500000
oral cavity0.500000
bronchial brush0.500000
san diego0.500000
periodontal pocket0.500000
bolivia0.500000
high hdl0.500000
LOWER IN low hdl0.500000
obsolete_juvenile stage0.500000
age<17 years0.500000
canada0.500000
atherosclerosis0.500000
native american0.500000
cheyenne0.500000
arapaho0.500000
LOWER IN american0.500000
bronchoalveolar lavage0.500000
idiopathic pulmonary fibrosis0.500000
uganda0.500000
pneumonia0.500000
age 6 months0.500000
LOWER IN bronchial epithelium0.500000
LOWER IN bronchial brush0.500000
LOWER IN bronchus0.500000
tracheal aspirate0.500000
respiratory technology dependent0.500000
cheek0.500000
formula fed0.500000
LOWER IN breast fed0.500000
luminal content0.500000
LOWER IN biopsy0.500000
LOWER IN biopsy site0.500000
hunter gatherer0.500000
sudan0.500000
chuquisaca department0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
nicotiana galuca0.500000
LOWER IN sinusitis0.500000
LOWER IN cron diet0.500000
LOWER IN cheek0.500000
metabolic syndrome x0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN skin under eye0.500000
pulpitis0.500000
amsterdam0.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
age 3-60.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
africa0.500000
stunted growth0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
train0.500000
boston0.500000
hypopharynx0.500000
LOWER IN age 1 week0.500000
new delhi0.500000
age >940.500000
antananarivo0.500000
madagascar0.500000
central african republic0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.909677
feces0.348387
united states of america0.309677
adult0.303226
saliva0.219355
china0.122581
mouth0.109677
child0.109677
infant0.096774
city0.058065
LOWER IN control0.058065
dentition0.058065
bronchial epithelium0.051613
subgingival plaque0.045161
control0.045161
bolivia0.045161
obsolete_juvenile stage0.045161
skin0.045161
india0.038710
oral wash0.038710
duodenum0.038710
colombia0.032258
lung0.032258
state of california0.032258
rural community0.032258
jiangsu province0.032258
africa0.032258
LOWER IN feces0.032258
mouth mucosa0.025806
oral cavity0.025806
bronchus0.025806
atlanta0.025806
age < 3 years0.025806
venezuela0.025806
hunter gatherer0.025806
amerindian0.025806
russia0.025806
sputum0.019355
bronchial brush0.019355
san diego0.019355
state of texas0.019355
italy0.019355
mouth neoplasm0.019355
cancer0.019355
canada0.019355
atherosclerosis0.019355
state of oklahoma0.019355
bronchoalveolar lavage0.019355
female0.019355
finland0.019355
pair of nares0.019355
diet0.019355
age 5-13 years0.019355
chuquisaca department0.019355
LOWER IN adult0.019355
brazil0.019355
age 8-120.019355
kingdom of denmark0.019355
age0.019355
LOWER IN left colon0.012903
LOWER IN sputum0.012903
LOWER IN induced sputum0.012903
aphthous stomatitis0.012903
czech republic0.012903
induced sputum0.012903
research facility0.012903
periodontal pocket0.012903
trachea0.012903
age<17 years0.012903
crohn's disease0.012903
ulcerative colitis0.012903
state of new york0.012903
hiv infection0.012903
uganda0.012903
pneumonia0.012903
tongue0.012903
male0.012903
LOWER IN female0.012903
south korea0.012903
mucosa0.012903
sinusoidal space0.012903
paranasal sinus0.012903
LOWER IN dentition0.012903
nasal cavity0.012903
LOWER IN biopsy0.012903
LOWER IN biopsy site0.012903
mucus0.012903
australia0.012903
age 3-60.012903
sichuan province0.012903
stunted growth0.012903
age 30-500.012903
new delhi0.012903
small intestine0.012903
age >940.012903
antananarivo0.012903
madagascar0.012903
age 13-140.012903
age 130.012903
juvenile organism0.012903
Exp. ID User ID Description Date Region Flag Sequences
409amnon high in right colon compared to left colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v4No1 / 1
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens infant vellore district city age 2 months india )2018-05-14v4No1 / 5
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
576amnon high in aphthous stomatitis compared to control in lower labial mucosa mouth mucosa lip adult czech republic homo sapiens 2020-01-09v3No1 / 10
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
576amnon high in aphthous stomatitis compared to control in adult czech republic mouth homo sapiens 2020-01-09v3No1 / 14
335amnondominant homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
54amnondominant homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 33
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy biopsy site in homo sapiens united states of america )2018-11-22v4No1 / 42
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950

Problems / suggestions? Please email info AT dbbact DOT org