Search result for sequence:
TGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGCTCATGGTCAAGCCGCGACATTGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG
common ontology terms
term enrichment score
TermScore
homo sapiens0.578477
saliva0.337921
adult0.315127
feces0.206121
united states of america0.179678
mouth0.172808
child0.155963
infant0.153453
dentition0.094030
china0.092156
bronchial epithelium0.090395
city0.090271
subgingival plaque0.078358
bolivia0.077348
obsolete_juvenile stage0.077348
skin0.069710
india0.068415
oral wash0.068182
duodenum0.064171
sputum0.057582
canada0.057307
colombia0.057034
lung0.056899
LOWER IN dentition0.055970
rural community0.054945
africa0.054945
LOWER IN control0.054899
LOWER IN feces0.052770
female0.051502
jiangsu province0.050761
state of california0.050336
trachea0.047151
mouth mucosa0.046422
bronchus0.046243
atlanta0.046243
age < 3 years0.046243
venezuela0.046243
amerindian0.046243
respiratory failure0.045714
acute respiratory failure0.045714
hunter gatherer0.045714
oral cavity0.045369
russia0.045198
commonwealth of pennsylvania0.041885
control0.041791
hospital0.041026
tracheal aspirate0.034985
state of oklahoma0.034985
toronto0.034985
LOWER IN supragingival dental plaque0.034985
bronchial brush0.034682
san diego0.034682
atherosclerosis0.034682
chuquisaca department0.034682
age 8-120.034682
finland0.034483
bronchoalveolar lavage0.034384
LOWER IN supragingival plaque0.034384
mouth neoplasm0.034091
cancer0.034091
tongue0.034091
age 5-13 years0.034091
kingdom of denmark0.033803
state of texas0.033520
brazil0.032967
pair of nares0.032698
italy0.032432
LOWER IN adult0.032432
diet0.031414
age0.030227
amsterdam0.023529
arm0.023529
LOWER IN left colon0.023392
LOWER IN sputum0.023392
LOWER IN induced sputum0.023392
induced sputum0.023392
endotracheal aspirate0.023392
mild disease course0.023392
state of new hampshire0.023392
periodontal pocket0.023392
oropharyngeal swab0.023392
age<17 years0.023392
state of new york0.023392
uganda0.023392
pneumonia0.023392
kingdom of the netherlands0.023392
LOWER IN biopsy0.023392
LOWER IN biopsy site0.023392
age 3-60.023392
stunted growth0.023392
age 30-500.023392
shanghai district0.023392
new delhi0.023392
age >940.023392
antananarivo0.023392
madagascar0.023392
age 13-140.023392
age 130.023392
glasgow0.023392
small village0.023392
Fraction of dbbact annotations with this term covered by the query
TermScore
trachea1.500000
bronchial epithelium0.800000
mouth mucosa0.750000
sputum0.750000
india0.714286
oral wash0.666667
tracheal aspirate0.666667
bronchus0.666667
atlanta0.666667
canada0.666667
state of oklahoma0.666667
age < 3 years0.666667
venezuela0.666667
amerindian0.666667
amsterdam0.666667
toronto0.666667
arm0.666667
LOWER IN supragingival dental plaque0.666667
saliva0.656250
subgingival plaque0.600000
colombia0.600000
mouth0.571429
lung0.571429
infant0.526316
colon0.500000
LOWER IN left colon0.500000
vellore district0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
lower labial mucosa0.500000
induced sputum0.500000
age 12-23 years0.500000
induced periodontitis0.500000
endotracheal aspirate0.500000
respiratory failure0.500000
acute respiratory failure0.500000
mild disease course0.500000
state of new hampshire0.500000
bronchial brush0.500000
san diego0.500000
periodontal pocket0.500000
bolivia0.500000
high hdl0.500000
LOWER IN low hdl0.500000
oropharyngeal swab0.500000
obsolete_juvenile stage0.500000
age<17 years0.500000
atherosclerosis0.500000
native american0.500000
cheyenne0.500000
arapaho0.500000
LOWER IN american0.500000
state of new york0.500000
idiopathic pulmonary fibrosis0.500000
uganda0.500000
pneumonia0.500000
LOWER IN bronchial epithelium0.500000
LOWER IN bronchial brush0.500000
LOWER IN bronchus0.500000
respiratory technology dependent0.500000
cheek0.500000
kingdom of the netherlands0.500000
formula fed0.500000
LOWER IN breast fed0.500000
luminal content0.500000
LOWER IN biopsy0.500000
LOWER IN biopsy site0.500000
hunter gatherer0.500000
sudan0.500000
chuquisaca department0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
nicotiana galuca0.500000
LOWER IN sinusitis0.500000
LOWER IN cron diet0.500000
LOWER IN cheek0.500000
metabolic syndrome x0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN skin under eye0.500000
pulpitis0.500000
age 8-120.500000
age one month0.500000
LOWER IN age one week0.500000
age 3-60.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
stunted growth0.500000
cameroon0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
train0.500000
boston0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.916168
adult0.353293
feces0.329341
united states of america0.323353
saliva0.227545
china0.125749
mouth0.101796
child0.101796
infant0.089820
city0.053892
LOWER IN control0.053892
dentition0.053892
bronchial epithelium0.047904
subgingival plaque0.041916
control0.041916
bolivia0.041916
obsolete_juvenile stage0.041916
skin0.041916
india0.035928
oral wash0.035928
female0.035928
duodenum0.035928
sputum0.029940
colombia0.029940
lung0.029940
canada0.029940
state of california0.029940
LOWER IN dentition0.029940
rural community0.029940
jiangsu province0.029940
africa0.029940
LOWER IN feces0.029940
mouth mucosa0.023952
oral cavity0.023952
hospital0.023952
commonwealth of pennsylvania0.023952
trachea0.023952
respiratory failure0.023952
acute respiratory failure0.023952
bronchus0.023952
atlanta0.023952
age < 3 years0.023952
venezuela0.023952
hunter gatherer0.023952
amerindian0.023952
russia0.023952
tracheal aspirate0.017964
bronchial brush0.017964
san diego0.017964
state of texas0.017964
italy0.017964
mouth neoplasm0.017964
cancer0.017964
atherosclerosis0.017964
state of oklahoma0.017964
bronchoalveolar lavage0.017964
tongue0.017964
finland0.017964
pair of nares0.017964
diet0.017964
age 5-13 years0.017964
chuquisaca department0.017964
LOWER IN adult0.017964
brazil0.017964
age 8-120.017964
kingdom of denmark0.017964
age0.017964
toronto0.017964
LOWER IN supragingival plaque0.017964
LOWER IN supragingival dental plaque0.017964
LOWER IN left colon0.011976
LOWER IN sputum0.011976
LOWER IN induced sputum0.011976
czech republic0.011976
aphthous stomatitis0.011976
induced sputum0.011976
research facility0.011976
endotracheal aspirate0.011976
mild disease course0.011976
cystic fibrosis0.011976
state of new hampshire0.011976
periodontal pocket0.011976
oropharynx0.011976
oropharyngeal swab0.011976
age<17 years0.011976
crohn's disease0.011976
ulcerative colitis0.011976
state of new york0.011976
hiv infection0.011976
uganda0.011976
pneumonia0.011976
male0.011976
LOWER IN female0.011976
south korea0.011976
mucosa0.011976
sinusoidal space0.011976
paranasal sinus0.011976
nasal cavity0.011976
kingdom of the netherlands0.011976
LOWER IN biopsy0.011976
Exp. ID User ID Description Date Region Flag Sequences
409amnon high in right colon compared to left colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v4No1 / 1
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens infant vellore district city age 2 months india )2018-05-14v4No1 / 5
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 10
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 13
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 14
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 14
335amnondominant homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 17
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
54amnondominant homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 33
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 33
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in formula fed diet compared to breast fed breast milk in homo sapiens kingdom of the netherlands nasopharynx nasal cavity infant )2017-11-03v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy biopsy site in homo sapiens united states of america )2018-11-22v4No1 / 42
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
339amnon high in infant age < 1 year compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral wash, oral cavity, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
335amnoncommon homo sapiens, bronchial epithelium, united states of america2018-05-16v4No1 / 61
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 78
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 291
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950

Problems / suggestions? Please email info AT dbbact DOT org