Search result for sequence:
TGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGACGGGGTTAATAACCCTGTCGATTGACGTTACCCGCAGAAGAAGCACCGGC
common ontology terms
term enrichment score
TermScore
food product type0.516129
canada0.482759
producer c10.347826
medicago sativa0.347826
alfalfa sprouts0.347826
mung bean sprouts0.347826
vigna radiata0.347826
producer c20.347826
african lion safari0.347826
captive0.222222
zoological garden0.181818
israel0.144144
eastern gray squirrel0.117647
sciurus carolinensis0.117647
bactrian camel0.117647
camelus bactrianus0.117647
red kangaroo0.117647
macropus rufus0.117647
toronto zoo0.117647
eland0.117647
tragelaphus oryx0.117647
giraffe0.111111
giraffa camelopardalis0.105263
white rhinoceros0.100000
ceratotherium simum0.100000
cow0.086957
bos taurus0.074074
skin0.073684
farm0.048780
Fraction of dbbact annotations with this term covered by the query
TermScore
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
mung bean sprouts0.500000
vigna radiata0.500000
producer c20.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
canada0.500000
african lion safari0.500000
bactrian camel0.500000
camelus bactrianus0.500000
red kangaroo0.500000
macropus rufus0.500000
toronto zoo0.500000
eland0.500000
tragelaphus oryx0.500000
giraffe0.333333
giraffa camelopardalis0.250000
white rhinoceros0.200000
ceratotherium simum0.200000
captive0.166667
zoological garden0.125000
cow0.125000
israel0.083333
bos taurus0.083333
skin0.040000
farm0.038462
Fraction of annotations for the query sequences containing the term
TermScore
food product type0.533333
israel0.533333
canada0.466667
skin0.466667
captive0.333333
zoological garden0.333333
producer c10.266667
medicago sativa0.266667
alfalfa sprouts0.266667
mung bean sprouts0.266667
vigna radiata0.266667
producer c20.266667
african lion safari0.266667
eastern gray squirrel0.066667
sciurus carolinensis0.066667
white rhinoceros0.066667
ceratotherium simum0.066667
bactrian camel0.066667
camelus bactrianus0.066667
giraffe0.066667
giraffa camelopardalis0.066667
cow0.066667
bos taurus0.066667
farm0.066667
red kangaroo0.066667
macropus rufus0.066667
toronto zoo0.066667
eland0.066667
tragelaphus oryx0.066667
Exp. ID User ID Description Date Region Flag Sequences
587amnondominant producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 12
587amnondominant mung bean sprouts, vigna radiata, producer c1, food product type, israel2020-02-10v3No1 / 15
587amnondominant producer c2, mung bean sprouts, vigna radiata, food product type, israel2020-02-10v3No1 / 23
587amnondominant producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 23
587amnoncommon mung bean sprouts, vigna radiata, producer c1, food product type, israel2020-02-10v3No1 / 42
587amnoncommon producer c2, mung bean sprouts, vigna radiata, food product type, israel2020-02-10v3No1 / 67
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
587amnoncommon producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 106
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
565amnoncommon bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 122
587amnoncommon producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 215
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
565amnoncommon cow, bos taurus, farm, canada, skin2019-11-21v3No1 / 318
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674

Problems / suggestions? Please email info AT dbbact DOT org