Search result for sequence:
TGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCATGAGCAAGCCCTTCGGGGTGAGTGTAGTGTTCGAATAAGCACCGGCTAACTACGTGCCAGCA
common ontology terms
term enrichment score
TermScore
gallbladder0.666667
bile0.666667
cholelithiasis0.666667
kingdom of spain0.142857
adult0.020202
LOWER IN control0.013986
homo sapiens0.010989
Fraction of dbbact annotations with this term covered by the query
TermScore
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
kingdom of spain0.076923
adult0.010204
LOWER IN control0.007143
homo sapiens0.005525
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
gallbladder1.000000
bile1.000000
adult1.000000
kingdom of spain1.000000
cholelithiasis1.000000
LOWER IN control0.333333

Problems / suggestions? Please email info AT dbbact DOT org