Search result for sequence:
TGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGGAGGCCTTCGGGTTGTAAACCGCTTTTGTTCATGAGCAAGCCCTTCGGGGTGAGTGTAGTGTTCGAATAAGCACCGGCTAACTACGTGCCAGCA
common ontology terms
term enrichment score
TermScore
gallbladder0.666667
bile0.666667
cholelithiasis0.666667
kingdom of spain0.100000
adult0.014388
LOWER IN control0.012422
homo sapiens0.008584
Fraction of dbbact annotations with this term covered by the query
TermScore
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
kingdom of spain0.052632
adult0.007246
LOWER IN control0.006329
homo sapiens0.004310
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
gallbladder1.000000
bile1.000000
adult1.000000
kingdom of spain1.000000
cholelithiasis1.000000
LOWER IN control0.333333

Problems / suggestions? Please email info AT dbbact DOT org