Search result for sequence:
TGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGT
common ontology terms
term enrichment score
TermScore
adult0.250057
homo sapiens0.205100
feces0.189873
italy0.170040
kingdom of spain0.145455
female0.134615
sus scrofa0.114130
taiwan0.102564
pig0.101695
china0.100766
zoological garden0.100719
captive0.100719
pemba island0.100000
new zealand0.100000
canada0.095238
tanzania0.090909
age 2-4 years0.083333
male0.074074
pregnancy0.071429
monkey0.071429
child0.069767
farm0.068966
sweden0.066667
colon0.063492
zhengzhou city prefecture0.062500
republic of china0.062500
municipality of yogyakarta0.062500
indonesia0.062500
europe0.062500
obesity0.061538
control0.060606
jiangxi province0.058824
msw0.057143
heterosexual0.057143
south korea0.056338
zhejiang province0.054054
cat0.054054
felis catus0.051282
hiv infection0.051282
age 1-18 years0.042553
sri lanka0.042553
gestational age 8-12 weeks0.042553
chengdu city prefecture0.042553
active disease0.042553
municipality of reus0.042553
autoimmune hepatitis0.042553
taipei city0.042553
gallbladder0.042553
bile0.042553
cholelithiasis0.042553
weaned0.042553
age 4-7 weeks0.042553
corn and soybean diet0.042553
central chimpanzee0.042553
african lion safari0.042553
LOWER IN cameroon0.042553
toronto zoo0.042553
wild boar0.041667
autistic disorder0.041667
shanghai district0.041667
egypt0.041667
age 30-500.041667
pan troglodytes troglodytes0.041667
cameroon0.041667
russia0.041237
guangzhou city prefecture0.040816
gay0.040816
lamb0.040816
skin0.040816
LOWER IN child0.040000
age 6 weeks0.040000
msm0.039216
homosexual0.039216
gorilla gorilla0.039216
czech republic0.038462
belgium0.037736
sheep0.036364
crohn's disease0.035714
research facility0.035593
ovis aries0.035088
wild0.030303
LOWER IN helminthiasis0.021739
LOWER IN pregnancy trimester 20.021739
LOWER IN pregnancy0.021739
non-pregnant0.021739
age 25-45 years0.021739
ismailia0.021739
LOWER IN tylosin phosphate0.021739
bihar state0.021739
gout0.021739
rheumatoid arthritis0.021739
midwest region0.021739
athlete0.021739
vegetarian diet0.021739
osteoarthritis0.021739
coronary heart disease0.021739
santa catarina state0.021739
omnivore diet0.021739
common bottlenose dolphin0.021739
novosibirsk0.021739
Fraction of dbbact annotations with this term covered by the query
TermScore
age 2-4 years0.666667
colon0.666667
taiwan0.666667
LOWER IN helminthiasis0.500000
pemba island0.500000
age 1-18 years0.500000
sri lanka0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
active disease0.500000
municipality of reus0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
new zealand0.500000
LOWER IN pregnancy trimester 20.500000
LOWER IN pregnancy0.500000
non-pregnant0.500000
age 25-45 years0.500000
ismailia0.500000
LOWER IN tylosin phosphate0.500000
bihar state0.500000
gout0.500000
rheumatoid arthritis0.500000
midwest region0.500000
athlete0.500000
vegetarian diet0.500000
republic of china0.500000
osteoarthritis0.500000
coronary heart disease0.500000
santa catarina state0.500000
omnivore diet0.500000
municipality of yogyakarta0.500000
indonesia0.500000
common bottlenose dolphin0.500000
taipei city0.500000
novosibirsk0.500000
LOWER IN age 4 months0.500000
LOWER IN age 2-4 years0.500000
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
low anterior resection0.500000
sus scrofa domesticus0.500000
south american tapir0.500000
tapirus terrestris0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN eastern chimpanzee0.500000
central chimpanzee0.500000
LOWER IN pan troglodytes verus0.500000
LOWER IN europe0.500000
african lion safari0.500000
LOWER IN age 0-6 months0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
europe0.500000
pan troglodytes verus0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
macropus rufus0.500000
red kangaroo0.500000
toronto zoo0.500000
camel0.500000
camelus dromedarius0.500000
rattus rattus0.500000
LOWER IN alpine pasture0.500000
LOWER IN alpine0.500000
lowland farm0.500000
lowland pasture0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
tragelaphus oryx0.500000
eland0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
african wild ass0.500000
equus ferus0.500000
obesity0.400000
wild boar0.333333
autistic disorder0.333333
shanghai district0.333333
egypt0.333333
sigmoid colon0.333333
age 30-500.333333
age 19-240.333333
tursiops truncatus0.333333
madrid0.333333
LOWER IN age 1-3 years0.333333
pan troglodytes troglodytes0.333333
cameroon0.333333
canada0.333333
giraffe0.333333
LOWER IN pan troglodytes troglodytes0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.833333
homo sapiens0.633333
adult0.511111
china0.211111
female0.155556
italy0.155556
kingdom of spain0.111111
control0.100000
sus scrofa0.077778
research facility0.077778
zoological garden0.077778
captive0.077778
pig0.066667
tanzania0.055556
pemba island0.055556
child0.055556
new zealand0.055556
male0.055556
sweden0.055556
taiwan0.055556
farm0.055556
monkey0.055556
skin0.055556
canada0.055556
pregnancy0.044444
age 2-4 years0.044444
zhejiang province0.033333
obesity0.033333
zhengzhou city prefecture0.033333
felis catus0.033333
cat0.033333
south korea0.033333
colon0.033333
msw0.033333
heterosexual0.033333
hiv infection0.033333
republic of china0.033333
municipality of yogyakarta0.033333
indonesia0.033333
jiangxi province0.033333
europe0.033333
age 1-18 years0.022222
sri lanka0.022222
wild boar0.022222
gestational age 8-12 weeks0.022222
chengdu city prefecture0.022222
autistic disorder0.022222
czech republic0.022222
active disease0.022222
crohn's disease0.022222
shanghai district0.022222
municipality of reus0.022222
autoimmune hepatitis0.022222
egypt0.022222
belgium0.022222
guangzhou city prefecture0.022222
age 30-500.022222
russia0.022222
msm0.022222
gay0.022222
homosexual0.022222
taipei city0.022222
LOWER IN child0.022222
gallbladder0.022222
bile0.022222
cholelithiasis0.022222
weaned0.022222
age 4-7 weeks0.022222
corn and soybean diet0.022222
central chimpanzee0.022222
pan troglodytes troglodytes0.022222
cameroon0.022222
wild0.022222
african lion safari0.022222
LOWER IN cameroon0.022222
toronto zoo0.022222
gorilla gorilla0.022222
lamb0.022222
age 6 weeks0.022222
ovis aries0.022222
sheep0.022222
LOWER IN helminthiasis0.011111
LOWER IN parasitic helminthiasis infectious disease0.011111
LOWER IN pregnancy trimester 20.011111
LOWER IN pregnancy0.011111
non-pregnant0.011111
age 25-45 years0.011111
ismailia0.011111
vagina0.011111
seoul0.011111
germany0.011111
biopsy0.011111
sigmoid colon0.011111
terminal ileum0.011111
LOWER IN tylosin phosphate0.011111
LOWER IN antibiotic0.011111
age 2 months0.011111
india0.011111
bihar state0.011111
gout0.011111
Exp. ID User ID Description Date Region Flag Sequences
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 1
656amnondominant age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 8
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 10
666amnondominant wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 11
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 11
564amnondominant homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 12
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 13
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 14
713amnondominant active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 16
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 16
713amnoncommon active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 17
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 19
732amnondominant municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 19
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 20
668amnondominant new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 22
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 30
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No1 / 33
700amnon high in control compared to tylosin phosphate antibiotic in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 33
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 34
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 38
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 38
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 39
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 42
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 45
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 45
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
707amnoncommon systemic lupus erythematosus, guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 48
736amnoncommon age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 51
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 53
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 53
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 54
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 55
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 60
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 60
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 62
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 63
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 66
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 69
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 70
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 71
707amnoncommon guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 75
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 78
668amnoncommon new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 78
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 84
668amnon high in age 5 years compared to age 4 months in new zealand research facility feces felis catus cat 2020-09-26v3No1 / 85
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to age 2-4 years child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 123
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 124
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 147
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 157
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 164
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 212
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 216
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 235
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 280
729amnon high in central chimpanzee pan troglodytes troglodytes cameroon wild compared to eastern chimpanzee pan troglodytes verus europe captive zoological garden in feces monkey 2021-01-05v3No1 / 288
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 298
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 302
723amnon high in age 2-4 years compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 310
666amnoncommon horse, equus caballus, italy, feces2020-09-25v3No1 / 334
729amnoncommon wild, cameroon, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 336
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v3No1 / 337
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 339
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 352
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 360
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 362
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 399
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 476
729amnoncommon captive, gorilla gorilla, monkey, feces, zoological garden, europe2021-01-05v3No1 / 542
725amnon high in subgingival dental plaque subgingival plaque compared to buccal mucosa mouth mucosa in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 544
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 666
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 673
666amnoncommon equus asinus africanus, african wild ass, feces, italy2020-09-25v3No1 / 676
666amnoncommon italy, feces, wild horse, equus ferus2020-09-25v3No1 / 708
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 889
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1253

Problems / suggestions? Please email info AT dbbact DOT org