Search result for sequence:
TGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA
common ontology terms
term enrichment score
TermScore
adult0.265701
homo sapiens0.257617
feces0.218606
taiwan0.155844
italy0.153015
kingdom of spain0.148472
child0.146341
china0.121417
republic of china0.113636
female0.113258
germany0.089955
2-5 year-old child stage0.088398
formula fed0.086486
obesity0.082902
sweden0.082005
control0.080429
indonesia0.080000
municipality of yogyakarta0.080000
2-year-old human stage0.076923
south korea0.073171
infant0.066914
pig0.062176
12-month-old human stage0.059113
breast fed0.058480
zhengzhou city prefecture0.058480
zoological garden0.058252
fifth decade human stage0.055249
guangzhou city prefecture0.053763
male0.052786
fourth decade human stage0.052356
sus scrofa0.049751
captive0.049140
monkey0.047393
pemba island0.047337
taoyuan city0.047337
taipei city0.047337
hangzhou city prefecture0.047337
age 6-14 years0.047337
estonia0.046243
gay0.045198
russia0.045198
tanzania0.045198
heterosexual0.044199
msw0.044199
homosexual0.043243
msm0.043243
pregnancy0.043243
zhejiang province0.042328
hiv infection0.039801
crohn's disease0.038278
high bmi0.037559
rheumatoid arthritis0.036254
weaned0.035928
corn and soybean diet0.035928
age 4-7 weeks0.035928
bile0.035928
gallbladder0.035928
autoimmune hepatitis0.035928
europe0.035928
age 1 month0.035608
autistic disorder0.035294
madrid0.035294
LOWER IN infant0.035294
biopsy0.034985
israel0.034934
jiangxi province0.034682
vagina0.034091
canada0.026786
research facility0.024938
bihar state0.024242
LOWER IN age 7 months0.024242
toronto zoo0.024242
sri lanka0.024242
age 1-18 years0.024242
child stage0.024242
novosibirsk0.024242
ismailia0.024242
non-pregnant0.024242
chengdu city prefecture0.024242
gestational age 8-12 weeks0.024242
municipality of reus0.024242
santa catarina state0.024242
vegetarian diet0.024242
low anterior resection0.024242
omnivore diet0.024242
before hsct0.024242
active disease0.024242
coronary heart disease0.024242
midwest region0.024242
graves' disease0.024242
type 1 diabetes mellitus0.024242
jinzhou city prefecture0.024242
hypersaline water0.024242
romania0.024242
ursu lake0.024242
depth 4-9m0.024242
monimolimnion0.024242
pan troglodytes verus0.024242
hefei city prefecture0.024242
baijiu0.024242
Fraction of dbbact annotations with this term covered by the query
TermScore
taiwan0.750000
republic of china0.666667
rheumatoid arthritis0.666667
weaned0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
bihar state0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
bile0.500000
gallbladder0.500000
toronto zoo0.500000
sri lanka0.500000
age 1-18 years0.500000
child stage0.500000
novosibirsk0.500000
ismailia0.500000
non-pregnant0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
municipality of reus0.500000
pemba island0.500000
santa catarina state0.500000
taoyuan city0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
age 0-6 months0.500000
vegetarian diet0.500000
age 7 months0.500000
taipei city0.500000
low anterior resection0.500000
valladolid0.500000
omnivore diet0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
before hsct0.500000
active disease0.500000
coronary heart disease0.500000
midwest region0.500000
graves' disease0.500000
type 1 diabetes mellitus0.500000
LOWER IN pregnancy0.500000
LOWER IN pregnancy trimester 20.500000
short beaked common dolphin0.500000
milan0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
common bottlenose dolphin0.500000
mucosa of stomach0.500000
jinzhou city prefecture0.500000
cholelithiasis0.500000
sus scrofa domesticus0.500000
hypersaline water0.500000
romania0.500000
ursu lake0.500000
depth 4-9m0.500000
monimolimnion0.500000
LOWER IN age 0-6 months0.500000
central chimpanzee0.500000
europe0.500000
pan troglodytes verus0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
western chimpanzee0.500000
african lion safari0.500000
macropus rufus0.500000
red kangaroo0.500000
LOWER IN depth 0-3m0.500000
LOWER IN mixolimnion0.500000
hefei city prefecture0.500000
baijiu0.500000
days 0-900.500000
18-month-old human stage0.500000
municipality of umea0.500000
days 180-2700.500000
ovis aries musimon0.500000
mouflon0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN age 2-4 weeks0.500000
equus ferus0.500000
panax notoginseng0.500000
xundian county0.500000
sanqi plants0.500000
ultisol0.500000
alabama0.500000
foot slope 0.500000
depth 90-100cm0.500000
2-5 year-old child stage0.400000
age 1 month0.400000
autistic disorder0.333333
pancreatic cancer0.333333
papio anubis0.333333
olive baboon0.333333
adolescent stage0.333333
madrid0.333333
age 25-45 years0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.850932
homo sapiens0.807453
adult0.534161
china0.223602
child0.130435
control0.130435
female0.111801
italy0.105590
kingdom of spain0.105590
germany0.093168
taiwan0.086957
republic of china0.062112
sweden0.055901
male0.055901
infant0.055901
2-5 year-old child stage0.049689
obesity0.049689
formula fed0.049689
indonesia0.043478
municipality of yogyakarta0.043478
2-year-old human stage0.043478
south korea0.043478
pig0.037267
12-month-old human stage0.037267
zoological garden0.037267
sus scrofa0.031056
breast fed0.031056
captive0.031056
research facility0.031056
guangzhou city prefecture0.031056
fourth decade human stage0.031056
fifth decade human stage0.031056
zhengzhou city prefecture0.031056
monkey0.031056
hiv infection0.024845
gay0.024845
homosexual0.024845
msm0.024845
israel0.024845
russia0.024845
pregnancy0.024845
crohn's disease0.024845
estonia0.024845
high bmi0.024845
tanzania0.024845
pemba island0.024845
taoyuan city0.024845
heterosexual0.024845
msw0.024845
taipei city0.024845
zhejiang province0.024845
hangzhou city prefecture0.024845
age 6-14 years0.024845
autistic disorder0.018634
LOWER IN control0.018634
farm0.018634
jiangxi province0.018634
weaned0.018634
corn and soybean diet0.018634
age 4-7 weeks0.018634
vagina0.018634
bile0.018634
gallbladder0.018634
skin0.018634
canada0.018634
madrid0.018634
age 1 month0.018634
autoimmune hepatitis0.018634
rheumatoid arthritis0.018634
biopsy0.018634
LOWER IN infant0.018634
europe0.018634
soil0.018634
pancreatic cancer0.012422
india0.012422
bihar state0.012422
LOWER IN age 7 months0.012422
papio anubis0.012422
olive baboon0.012422
toronto zoo0.012422
sri lanka0.012422
age 1-18 years0.012422
child stage0.012422
adolescent stage0.012422
novosibirsk0.012422
egypt0.012422
ismailia0.012422
age 25-45 years0.012422
non-pregnant0.012422
belgium0.012422
remission0.012422
ketogenic diet0.012422
chengdu city prefecture0.012422
gestational age 8-12 weeks0.012422
municipality of reus0.012422
age 1-3 years0.012422
1-year-old human stage0.012422
brazil0.012422
santa catarina state0.012422
vegetarian diet0.012422
Exp. ID User ID Description Date Region Flag Sequences
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 5
521amnonhigh freq. in weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 9
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
831amnondominant feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 14
570amnondominant feces, homo sapiens, india, bihar state2019-12-16v3No1 / 15
723amnoncommon homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
526amnonhigh freq. in bile of healthy controls (dominant homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 16
565amnondominant zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 16
656amnondominant feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 16
680amnondominant feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 16
723amnondominant feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 16
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
724amnoncommon homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 17
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
797amnondominant feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
831amnondominant feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 18
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
732amnondominant feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 19
736amnondominant feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 19
736amnondominant feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 19
757amnondominant feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
529amnonhigh freq. in patients that underwent low anterior resection (dominant feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 21
593amnondominant feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 21
825amnondominant feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 21
835amnondominant feces, homo sapiens, adult, japan2021-09-11v3No1 / 21
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
593amnondominant feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
666amnondominant feces, homo sapiens, italy2020-09-25v3No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
713amnondominant feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 23
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
825amnondominant feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 28
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, stomach, biopsy, south korea, mucosa of stomach)2019-12-16v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
577amnoncommon lake, water, high salinity, lake water, hypersaline water, romania, ursu lake, depth 4-9m, monimolimnion2020-01-09v3No1 / 303
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
729amnon high in zoological garden captive europe pan troglodytes verus eastern chimpanzee compared to pan troglodytes troglodytes cameroon central chimpanzee in feces monkey 2021-01-05v3No1 / 337
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
577amnon high in high salinity hypersaline water depth 4-9m monimolimnion compared to low salinity depth 0-3m mixolimnion in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
666amnoncommon feces, italy, equus ferus, wild horse2020-09-25v3No1 / 715
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783

Problems / suggestions? Please email info AT dbbact DOT org