Search result for sequence:
TGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTAGCGAGGAAGGCATTTAGTTTAATAGACTAGATGATTGACGTTAACTACAGAAGAAGCACCGGC
common ontology terms
term enrichment score
TermScore
dermal layer of tongue0.533333
LOWER IN supragingival plaque0.400000
LOWER IN dentition0.333333
tongue0.296296
LOWER IN liver carcinoma0.222222
pancreatic cancer0.222222
late adult stage0.222222
age 7-14 years0.222222
shanghai proper0.200000
age 1-7 years0.200000
saliva0.171429
LOWER IN age < 1 year0.166667
child0.133333
sweden0.117647
city0.080000
china0.055300
homo sapiens0.043956
adult0.019802
control0.014151
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN supragingival plaque0.666667
dermal layer of tongue0.500000
LOWER IN liver carcinoma0.500000
pancreatic cancer0.500000
late adult stage0.500000
age 7-14 years0.500000
LOWER IN dentition0.400000
shanghai proper0.333333
age 1-7 years0.333333
tongue0.200000
LOWER IN age < 1 year0.200000
saliva0.107143
sweden0.100000
child0.086957
city0.055556
china0.028571
homo sapiens0.022472
adult0.010638
control0.007194
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
china0.857143
tongue0.571429
dermal layer of tongue0.571429
control0.428571
saliva0.428571
LOWER IN dentition0.285714
LOWER IN supragingival plaque0.285714
child0.285714
LOWER IN liver carcinoma0.142857
pancreatic cancer0.142857
adult0.142857
late adult stage0.142857
city0.142857
shanghai proper0.142857
age 7-14 years0.142857
sweden0.142857
age 1-7 years0.142857
LOWER IN age < 1 year0.142857

Problems / suggestions? Please email info AT dbbact DOT org