Search result for sequence:
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTTACCCGGGATGATAATGACAGTACCGGGAGAATAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA
common ontology terms
term enrichment score
TermScore
soil0.282248
agricultural field0.277992
pot expreiment0.213904
triticum aestivum0.190715
bulk soil0.182143
lettuce0.169492
maize field0.147239
kingdom of denmark0.144928
ph 70.135593
ph 7.60.130178
germany0.122596
thyrow0.119760
loam soil0.112150
china0.111732
rhizosphere0.111188
flood plain0.109091
sacramento0.109091
cosumnes river preserve0.109091
switzerland0.106952
haplic luvisol0.103448
guizhou province0.098160
kaiyang county0.098160
bernburg0.098160
crop rotation0.098160
dekalb county0.098160
illinois0.098160
wheat0.089385
depth 0-10cm0.088073
lund0.086957
clayey till0.086957
late weichselian glaciation0.086957
mineral fertilization0.086957
albic luvisol0.086957
ultisol0.086957
alabama0.086957
state of illinois0.085561
npk fertilization0.083333
auburn0.083333
biochar0.080000
zoological garden0.077295
after 6 years0.075472
organic fertilization0.075472
cigar0.075472
tobacco0.075472
captive0.074419
manure fertilization0.072727
nicotiana tabacum0.072727
manured soil0.065574
depth 0-30cm0.063694
therwil0.063694
toronto zoo0.063694
panax notoginseng0.063694
xundian county0.063694
sanqi plants0.063694
neve yaar0.063694
state of sabah0.063694
land snail0.063694
alfisol0.063694
hapludalf0.063694
sandy loam0.063694
foot slope 0.063694
canada0.063492
silt loam0.061728
yunnan province0.061728
malaysia0.061728
sandy loam soil0.061728
irrigated0.059880
italy0.059701
ph 60.056497
farm0.055300
gastrointestinal system0.054945
ice0.052288
apennine mountains0.051613
prunus armeniaca0.051613
apricot0.051613
cucumber0.051613
high biochar0.051613
ph 6.40.051613
jilin province0.051613
glacier0.050955
unamended soil0.050314
orchard0.050314
filtered 0.2um0.050314
black soil0.050314
state of california0.049587
ph 7-80.049080
israel0.048193
depth 10 cm0.047904
skin0.045977
stomach0.044053
shanxi province0.039604
maize pre-crop0.039216
bio-dynamic fertilizer0.039216
cheyenne full flavor cigar0.039216
alycaeus jagori0.039216
mollisol0.038462
depth 0-20cm0.036364
LOWER IN rhizosphere0.034783
wild horse0.026667
bretagne region0.026490
Fraction of dbbact annotations with this term covered by the query
TermScore
maize field0.750000
loam soil0.666667
shanxi province0.666667
ice0.666667
wild horse0.666667
agricultural field0.571429
bretagne region0.500000
guizhou province0.500000
kaiyang county0.500000
after 6 years0.500000
ph 80.500000
apennine mountains0.500000
prunus armeniaca0.500000
apricot0.500000
lund0.500000
clayey till0.500000
late weichselian glaciation0.500000
plough layer 0.500000
chromic cambisol0.500000
depth 0-30cm0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
ph 7.60.500000
cucumber0.500000
bacillus amyloliquefaciens sqr90.500000
bernburg0.500000
crop rotation0.500000
maize pre-crop0.500000
orthic anthrosol0.500000
pot expreiment0.500000
lettuce0.500000
organic fertilization0.500000
therwil0.500000
bio-dynamic fertilizer0.500000
ph 6.60.500000
cultivator tillage0.500000
rapeseed pre-crop0.500000
canis lupus arctos0.500000
toronto zoo0.500000
arctic wolf0.500000
high biochar0.500000
low biochar0.500000
panax notoginseng0.500000
xundian county0.500000
sanqi plants0.500000
loess chernozem0.500000
mouldboard plough0.500000
straw0.500000
loam0.500000
neve yaar0.500000
mineral fertilization0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
loamy sand soil0.500000
cigar0.500000
tobacco0.500000
cheyenne full flavor cigar0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
glacial ice0.500000
shetland islands0.500000
south shetland glacier0.500000
LOWER IN cholelithiasis0.500000
bile0.500000
gallbladder0.500000
omsk0.500000
peking duck0.500000
state of sabah0.500000
opisthostoma concinnum0.500000
plectostoma concinnum0.500000
land snail0.500000
panthera tigris0.500000
tiger0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
alycaeus jagori0.500000
subsurface0.500000
depth 20-100cm0.500000
cheyenne menthol box cigar0.500000
time 00.500000
LOWER IN time 5 days0.500000
LOWER IN fermented cocoa mass0.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
african lion safari0.500000
swisher sweets original cigar0.500000
swisher sweets sweet cherry cigar0.500000
ammotragus lervia0.500000
barbary sheep0.500000
glycine soja0.500000
jilin province0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.619048
china0.204082
agricultural field0.183673
pot expreiment0.136054
triticum aestivum0.129252
bulk soil0.115646
united states of america0.115646
germany0.115646
rhizosphere0.108844
kingdom of denmark0.102041
lettuce0.102041
skin0.095238
canada0.095238
maize field0.081633
ph 70.081633
ph 7.60.074830
switzerland0.068027
thyrow0.068027
loam soil0.061224
state of california0.061224
flood plain0.061224
sacramento0.061224
cosumnes river preserve0.061224
haplic luvisol0.061224
guizhou province0.054422
kaiyang county0.054422
bernburg0.054422
crop rotation0.054422
wheat0.054422
zoological garden0.054422
captive0.054422
depth 0-10cm0.054422
state of illinois0.054422
dekalb county0.054422
illinois0.054422
biochar0.047619
lund0.047619
clayey till0.047619
late weichselian glaciation0.047619
npk fertilization0.047619
mineral fertilization0.047619
albic luvisol0.047619
ultisol0.047619
auburn0.047619
alabama0.047619
after 6 years0.040816
italy0.040816
farm0.040816
manured soil0.040816
manure fertilization0.040816
organic fertilization0.040816
israel0.040816
nicotiana tabacum0.040816
cigar0.040816
tobacco0.040816
silt loam0.034014
depth 0-30cm0.034014
therwil0.034014
toronto zoo0.034014
yunnan province0.034014
ph 60.034014
panax notoginseng0.034014
xundian county0.034014
sanqi plants0.034014
irrigated0.034014
neve yaar0.034014
stomach0.034014
gastrointestinal system0.034014
malaysia0.034014
state of sabah0.034014
land snail0.034014
sandy loam soil0.034014
alfisol0.034014
hapludalf0.034014
sandy loam0.034014
foot slope 0.034014
unamended soil0.027211
orchard0.027211
depth 10 cm0.027211
ph 7-80.027211
apennine mountains0.027211
prunus armeniaca0.027211
apricot0.027211
cucumber0.027211
high biochar0.027211
ph 6.40.027211
glacier0.027211
ice0.027211
filtered 0.2um0.027211
black soil0.027211
jilin province0.027211
shanxi province0.020408
maize pre-crop0.020408
bio-dynamic fertilizer0.020408
cheyenne full flavor cigar0.020408
control0.020408
feces0.020408
alycaeus jagori0.020408
depth 0-20cm0.020408
LOWER IN rhizosphere0.020408
Exp. ID User ID Description Date Region Flag Sequences
768sheryoDom inant in maize fields in Brittany, France (dominant soil, cambisol, zea mays, french republic, maize field, bretagne region)2021-04-18v3No1 / 1
631sheryodominant in maize field unamended bulk soil (dominant soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 3
631sheryodominant in maize field biochar amended bulk soil, after 6 years of biochar amended (dominant soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 3
798amnondominant orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 3
827sheryoDominant in soil at 25cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 3
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 4
765sheryoDominant in wheat field in the loess plateau in china (dominant soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 0-30cm depth (dominant united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 5
631sheryodominant in maize field unamended rhizosphere soil (dominant soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 6
754sheryoDominant in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (dominant soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 6
764sheryoDominant in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 7
531amnondominant farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 8
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (dominant soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (dominant soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, maize pre-crop, rapeseed pre-crop)2021-04-12v3No1 / 8
565amnondominant zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar, low biochar)2020-04-21v3No1 / 9
752sheryoDominant in soil planted with Panax notoginseng amended with 2% biochar (dominant soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 9
764sheryoDominant in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (dominant soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 9
565amnondominant farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw, high biochar)2020-04-21v3No1 / 10
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-22v3No1 / 10
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 10
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
752sheryoDominant in soil planted with Panax notoginseng (dominant soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 13
662amnondominant soil, israel, depth 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 14
758amnondominant in cigar tobacco (dominant nicotiana tabacum, cigar, tobacco, cheyenne full flavor cigar)2021-03-28v3No1 / 14
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol from Germany (dominant soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (dominant soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 15
811amnondominant glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 16
526amnon high in control compared to cholelithiasis in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 17
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 25
565amnoncommon skin, felis catus, cat, canada2019-11-21v3No1 / 26
696amnoncommon stomach, gastrointestinal system, malaysia, state of sabah, opisthostoma concinnum, plectostoma concinnum, land snail2028-03-27v3No1 / 36
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
682amnoncommon city, air, kingdom of spain, madrid2028-03-04v3No1 / 67
696amnoncommon stomach, gastrointestinal system, malaysia, state of sabah, alycaeus jagori, land snail2028-03-27v3No1 / 74
763amnoncommon glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 74
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
565amnoncommon zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 112
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne menthol box cigar)2021-03-28v3No1 / 115
789amnonhigh in unfemented compared to fermented cocoa mass ( high in time 0 compared to time 5 days fermented cocoa mass in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 121
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets original cigar)2021-03-28v3No1 / 127
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne full flavor cigar)2021-03-28v3No1 / 128
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets sweet cherry cigar)2021-03-28v3No1 / 154
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 210
583amnoncommon mountain, soil, switzerland, depth 0-10cm, ph 4-6, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
585amnoncommon intestine, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 240
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 294
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 317
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to manured soil manure fertilization organic fertilization bio-dynamic fertilizer in soil bulk soil switzerland pot expreiment lettuce haplic luvisol therwil )2021-04-07v3No1 / 347
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common soil, rhizosphere, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, lettuce, mineral fertilization)2021-04-08v3No1 / 353
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common soil, manured soil, rhizosphere, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, lettuce, organic fertilization)2021-04-08v3No1 / 359
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
758amnon high in cheyenne full flavor cigar cheyenne menthol box cigar compared to swisher sweets original cigar swisher sweets sweet cherry cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 452
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 481
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-21v3No1 / 489
798amnoncommon orchard, hay, italy, depth 10 cm, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag2021-06-13v3No1 / 508
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
662amnon high in wastewater treatment plant treated wastewater compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in soil switzerland thyrow pot expreiment lettuce haplic luvisol )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
696amnon high in opisthostoma concinnum plectostoma concinnum compared to georissa georissa similis in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 606
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 609
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth 0-30cm compared to depth 30-60cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 627
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil state of illinois mollisol silt loam dekalb county illinois )2021-08-26v3No1 / 631
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 648
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 25-50cm)2021-08-07v3No1 / 652
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 685
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
666amnoncommon feces, italy, equus ferus, wild horse2020-09-25v3No1 / 715
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 721
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common soil, depth 0-10cm, agricultural field, ultisol, upland soil, auburn, alabama)2021-08-07v3No1 / 730
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 737
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 30-50cm)2021-08-08v3No1 / 753
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 50-90cm)2021-08-08v3No1 / 815
583amnoncommon mountain, soil, switzerland, depth 0-10cm, ph 7-8, canton of graubunden, elevation 2000-3000m, calcareous parent material2020-01-28v3No1 / 830
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
698amnoncommon park, rhizosphere, disease, ph 5-6, depth 0-30cm, united kingdom, quercus, oak, acute oak decline, plant disease2028-04-01v3No1 / 848
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
807amnoncommon surface water, sea water, summer, near shore, filtered 0.2um, tropical storm, japan, okinawa islands2021-06-20v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 27-56cm)2021-08-26v3No1 / 906
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 166-200cm)2021-05-18v3No1 / 936
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
768sheryoCommon in maize fields in Brittany, France (common soil, cambisol, zea mays, french republic, maize field, bretagne region)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
765sheryocommon in wheat field in the loess plateau in china (common soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 1087
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
698amnoncommon control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
807amnon high in tropical storm compared to normal weather in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 1191
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 0-15cm, foot slope )2021-08-08v3No1 / 1199
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 15-30cm, foot slope )2021-08-08v3No1 / 1218
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
798amnoncommon orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot2021-06-13v3No1 / 1230
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, depth 0-20cm, china, saccharum, sugarcane, ph 6.7)2020-04-27v3No1 / 1277
798amnon high in soil ph 7-8 compared to hay plant litter litter bag in orchard italy depth 10 cm apennine mountains prunus armeniaca apricot 2021-06-13v3No1 / 1285
631sheryoCommon in maize field biochar amended rhizosphere soil (common soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 1492
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1672
696amnon high in alycaeus jagori compared to georissa georissa similis in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1698
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common soil, fertilized soil, topsoil, guangzhou city prefecture, depth 0-20cm, china, saccharum, sugarcane, ph 5.5-6)2020-04-27v3No1 / 1710
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872

Problems / suggestions? Please email info AT dbbact DOT org