Search result for sequence:
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAATTAATACTTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGC
common ontology terms
term enrichment score
TermScore
ant0.229358
united states of america0.201794
homo sapiens0.169811
canada0.165478
pacific ocean0.160858
costa rica0.157233
skin0.154774
ocean0.149457
larval stage0.134831
stomach0.134694
calvert island0.115789
alga0.115789
province of british columbia0.109453
soil0.106157
sweden0.094488
rhizosphere0.093897
adult0.084922
digestive system0.082418
feces0.080569
child0.079162
china0.071111
intestine0.068807
germany0.065041
texas0.062500
research facility0.062294
sea water0.059172
whole body0.055402
body proper0.053908
fungus growing ant0.050847
cambridgeshire0.050847
panama0.049587
newt0.049587
fish0.048387
saliva0.047619
state of california0.047525
state of idaho0.045455
water0.043956
bird0.043956
infant0.043668
united kingdom0.043165
australia0.038647
cat0.037736
italy0.037736
felis catus0.036364
wheat0.034783
army ant0.034483
gaster0.034483
ceratitis capitata0.034483
mediterranean fruit fly0.034483
depth 0-20cm0.034188
LOWER IN control0.034115
new york city0.033333
plant0.033333
root0.033149
winter0.031496
control0.029787
sinusoidal space0.029112
paranasal sinus0.029112
pseudomyrmex flavicornis0.028902
pseudomyrmex spinicola0.028902
nile tilapia0.028902
lissotriton vulgaris0.028902
pet0.028902
food product type0.028902
brassicaceae0.028902
boechera stricta0.028902
nasal cavity0.028798
frog0.028763
tree0.028694
pair of nares0.028592
caecum0.028571
oreochromis niloticus0.028490
cultivated environment0.028090
depth 0-10cm0.028090
marine sediment0.027829
mexico0.027701
canis lupus familiaris0.027574
kingdom of spain0.027322
israel0.025253
linepithema humile0.023256
argentine ant0.023256
pseudomyrmex nigropilosus0.023256
pseudomyrmex cubaensis0.023256
coturnix coturnix0.023256
pseudomyrmex gracilis0.023256
pseudomyrmex elongatus0.023256
sinusitis0.023256
orchard0.023256
triturus cristatus0.023256
pseudomyrmex nigrocinctus0.023256
medicago sativa0.023256
alfalfa sprouts0.023256
chuquisaca department0.023256
taxus0.023256
north china plain0.023256
colon0.023202
state of oregon0.023121
bronchial epithelium0.023121
crematogaster0.022989
citrus0.022989
Fraction of dbbact annotations with this term covered by the query
TermScore
canada2.000000
bronchus0.666667
sinusoidal space0.666667
paranasal sinus0.666667
graz city district0.666667
LOWER IN subtropical0.666667
depth 4000m0.666667
wheat0.666667
ant0.500000
pseudomyrmex flavicornis0.500000
metabolic syndrome x0.500000
LOWER IN resistant starch type 4 diet0.500000
ginger0.500000
state of rhode island0.500000
LOWER IN allergy0.500000
LOWER IN atopic dermatitis0.500000
linepithema humile0.500000
argentine ant0.500000
catfish0.500000
pseudomyrmex spinicola0.500000
pheidole0.500000
pseudomyrmex nigropilosus0.500000
pseudomyrmex cubaensis0.500000
quail0.500000
coturnix coturnix0.500000
eciton burchellii0.500000
army ant0.500000
gaster0.500000
labidus praedator0.500000
neivamyrmex0.500000
annona cherimola0.500000
ceratitis capitata0.500000
mediterranean fruit fly0.500000
pseudomyrmex gracilis0.500000
pseudomyrmex elongatus0.500000
coreius guichenoti0.500000
largemouth bronze gudgeon0.500000
freshwater river biome0.500000
yangtze river0.500000
sinusitis0.500000
fungus growing ant0.500000
atta sexdens0.500000
nile tilapia0.500000
sericomyrmex amabilis0.500000
apterostigma dentigerum0.500000
myrmicocrypta ednaella0.500000
orchard0.500000
citrus sinensis0.500000
orange0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
cyphomyrmex costatus0.500000
train0.500000
boston0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
atta cephalotes0.500000
pseudomyrmex nigrocinctus0.500000
pseudomyrmex pallidus0.500000
atta colombica0.500000
outdoor0.500000
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
lower back0.500000
indoor0.500000
office0.500000
carnivorous beetle0.500000
raba river0.500000
bembidion punctulatum0.500000
skin of face0.500000
skin under eyes0.500000
small size0.500000
LOWER IN medium size0.500000
LOWER IN large size0.500000
stratovolcano0.500000
snow0.500000
mycocepurus smithii0.500000
age 2 years0.500000
contact lens0.500000
ficus carica0.500000
fig0.500000
prunus persica0.500000
peach0.500000
pseudomyrmex viduus0.500000
eelgrass0.500000
melopsittacus undulatus0.500000
parakeet0.500000
pseudomyrmex simplex0.500000
nida basin0.500000
herbivorous beetle0.500000
eusomus ovulum0.500000
anal swab0.500000
myotis myotis0.500000
bat0.500000
greater mouse eared bat0.500000
reagent0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.357143
homo sapiens0.187500
ant0.148810
costa rica0.148810
pacific ocean0.104167
stomach0.098214
ocean0.098214
larval stage0.095238
skin0.092262
canada0.086310
feces0.083333
soil0.074405
adult0.074405
research facility0.065476
province of british columbia0.065476
calvert island0.065476
alga0.065476
china0.062500
rhizosphere0.059524
digestive system0.053571
sweden0.053571
child0.050595
intestine0.044643
texas0.035714
sea water0.035714
saliva0.035714
germany0.035714
body proper0.029762
whole body0.029762
state of california0.026786
fish0.026786
water0.026786
panama0.026786
fungus growing ant0.026786
newt0.026786
cambridgeshire0.026786
united kingdom0.026786
LOWER IN control0.023810
bird0.023810
infant0.023810
state of idaho0.023810
cat0.020833
felis catus0.020833
control0.020833
italy0.020833
caecum0.020833
australia0.020833
army ant0.017857
gaster0.017857
ceratitis capitata0.017857
mediterranean fruit fly0.017857
new york city0.017857
plant0.017857
winter0.017857
root0.017857
wheat0.017857
depth 0-20cm0.017857
pseudomyrmex flavicornis0.014881
pseudomyrmex spinicola0.014881
colon0.014881
sinusoidal space0.014881
paranasal sinus0.014881
oreochromis niloticus0.014881
nile tilapia0.014881
kingdom of spain0.014881
cultivated environment0.014881
lissotriton vulgaris0.014881
mexico0.014881
pet0.014881
food product type0.014881
israel0.014881
frog0.014881
nasal cavity0.014881
pair of nares0.014881
marine sediment0.014881
canis lupus familiaris0.014881
brassicaceae0.014881
boechera stricta0.014881
tree0.014881
depth 0-10cm0.014881
contamination0.011905
linepithema humile0.011905
argentine ant0.011905
pseudomyrmex nigropilosus0.011905
pseudomyrmex cubaensis0.011905
coturnix coturnix0.011905
pseudomyrmex gracilis0.011905
pseudomyrmex elongatus0.011905
mucosa0.011905
sinusitis0.011905
crematogaster0.011905
citrus0.011905
orchard0.011905
triturus cristatus0.011905
pseudomyrmex nigrocinctus0.011905
cephalotes0.011905
air0.011905
medicago sativa0.011905
alfalfa sprouts0.011905
beetle0.011905
Exp. ID User ID Description Date Region Flag Sequences
408amnon high in stomach compared to larval stage in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 1
408amnoncommon ant, costa rica, united states of america, stomach, camponotus2018-11-22v4No1 / 2
408amnoncommon ant, costa rica, united states of america, camponotus, larval stage2018-11-22v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 3
311amnondominant ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 4
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to allergy atopic dermatitis in cat felis catus skin united states of america )2017-07-05v4No1 / 5
182amnondominant argentina, linepithema humile, argentine ant, body proper2017-08-15v4No1 / 5
255amnondominant catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 5
408amnon high in stomach compared to larval stage in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnoncommon ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigropilosus, stomach2018-11-22v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 5
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
108amnondominant research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 6
183amnoncommon eciton burchellii, army ant, stomach, gaster2017-08-15v4No1 / 6
183amnoncommon army ant, stomach, gaster, labidus praedator2017-08-15v4No1 / 6
408amnondominant ant, costa rica, united states of america, eciton, stomach2018-11-22v4No1 / 6
52amnoncommon homo sapiens, skin, nipple, state of california2017-01-19v4No1 / 7
182amnoncommon argentina, linepithema humile, argentine ant, body proper2017-08-15v4No1 / 7
182amnondominant linepithema humile, argentine ant, body proper, united states of america2017-08-15v4No1 / 7
183amnoncommon neivamyrmex, army ant, stomach, gaster2017-08-15v4No1 / 7
346amnonhigh freq. in fruitfly larva grown on annona (dominant larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 7
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, larval stage2018-11-22v4No1 / 7
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
115amnondominant coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 8
182amnoncommon linepithema humile, argentine ant, body proper, united states of america2017-08-15v4No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 8
235amnoncommon in ocean water above eelgrass from various northern hemisphere sites (common water, sea water)2017-11-07v4No1 / 8
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 8
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 8
408amnondominant ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 8
108amnondominant research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v4No1 / 9
397amnondominant panama, digestive system, intestine, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 9
397amnoncommon panama, digestive system, intestine, fungus growing ant, apterostigma dentigerum2018-11-14v4No1 / 9
397amnondominant panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 9
408amnondominant ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 9
408amnoncommon ant, costa rica, united states of america, eciton, stomach2018-11-22v4No1 / 9
415amnondominant rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 9
58amnondominant homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
346amnoncommon in fruitfly larva grown on orange (common larval stage, body proper, citrus sinensis, italy, whole body, orange, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
397amnoncommon panama, digestive system, intestine, fungus growing ant, cyphomyrmex costatus2018-11-14v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, larval stage2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 10
183amnondominant eciton burchellii, army ant, stomach, gaster2017-08-15v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, train, boston)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 11
302amnonhigh freq. in feces of canary pet birds (dominant bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
397amnondominant panama, digestive system, intestine, fungus growing ant, atta cephalotes2018-11-14v4No1 / 11
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
397amnondominant panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 12
408amnondominant ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 12
408amnondominant ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 12
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 12
408amnondominant ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 12
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 12
460amnonhigh freq. in outdoor air (dominant air, united states of america, state of california, outdoor)2019-01-12v4No1 / 12
587amnondominant producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 12
596amnondominant age 1 year, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 12
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (dominant air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 13
515amnondominant carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 13
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
115amnonlower in medium and large size fish compared to small size ( high in small size compared to medium size large size in coreius guichenoti largemouth bronze gudgeon fish freshwater river biome yangtze river intestine china )2017-04-10v4No1 / 14
183amnondominant army ant, stomach, gaster, labidus praedator2017-08-15v4No1 / 14
183amnondominant neivamyrmex, army ant, stomach, gaster2017-08-15v4No1 / 14
224amnondominant united states of america, state of oregon, snow field, glacier, stratovolcano, snow2017-10-26v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
408amnondominant ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 14
596amnondominant infant, age 6 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 14
596amnondominant age 2 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 14
596amnondominant age 3 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, italy, whole body, peach, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 15
408amnondominant ant, costa rica, united states of america, pseudomyrmex viduus, larval stage2018-11-22v4No1 / 15
133amnoncommon in infants 0-1 years (common homo sapiens, infant, nasopharynx, australia)2017-04-16v4No1 / 16
408amnoncommon ant, cephalotes, costa rica, united states of america, larval stage2018-11-22v4No1 / 16
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 17
158amnondominant cat, felis catus, united states of america, axilla2017-07-06v4No1 / 17
408amnondominant ant, costa rica, united states of america, pseudomyrmex gracilis, larval stage2018-11-22v4No1 / 17
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 17
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 17
158amnondominant cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 18
235amnoncommon in eelgrass leaf (common ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 18
302amnonhigh freq. in feces of parakeet pet birds (dominant bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 18
408amnoncommon ant, cephalotes, stomach, costa rica, united states of america2018-11-22v4No1 / 18
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 18
408amnondominant ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin australia foot )2017-11-05v4No1 / 19
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
489amnondominant feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 19
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
408amnondominant ant, cephalotes, stomach, costa rica, united states of america2018-11-22v4No1 / 20
492amnondominant skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
593amnondominant rheumatoid arthritis, south korea, adult, feces, homo sapiens2020-03-08v3No1 / 21
596amnoncommon age 3 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 21
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
587amnondominant producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 23
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in nasal cavity bos taurus calve united states of america juvenile organism pair of nares )2017-07-04v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 27
58amnoncommon homo sapiens, new york city, conjunctiva2017-02-02v4No1 / 28
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
596amnon high in age 2 years compared to age 7 years in child saliva sweden homo sapiens 2020-03-18v3No1 / 28
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 30
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
108amnoncommon research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
596amnoncommon infant, age 6 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 35
596amnoncommon age 1 year, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 37
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 42
587amnoncommon mung bean sprouts, vigna radiata, producer c1, food product type, israel2020-02-10v3No1 / 42
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
408amnoncommon ant, costa rica, united states of america, pseudomyrmex viduus, larval stage2018-11-22v4No1 / 47
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
596amnoncommon age 2 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
596amnoncommon age 7 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 59
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in drinking water united states of america water biofilm )2017-09-12v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (common canada, province of british columbia, calvert island, pacific ocean, ocean, alga, mastocarpus alaskensis, mastocarpus, crustose sporophyte)2018-08-01v4No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
77amnoncommon kelp forest, algae, ecklonia radiata, winter, australia2017-02-28v4No1 / 76
569amnoncommon in gastric biopsies of patients positive for h. pylori (common helicobacter pylori infectious disease, biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 77
596amnon high in age <1 year compared to age 1-7 years in child saliva sweden homo sapiens 2020-03-18v3No1 / 78
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
569amnoncommon in gastric biopsies of patients negative for h. pylori (common biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 85
108amnon high in caecum compared to colon in research facility texas united states of america mus musculus mouse 2017-04-07v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
355amnonlower in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in upright gametophyte compared to crustose sporophyte in canada province of british columbia calvert island pacific ocean ocean alga mastocarpus alaskensis mastocarpus )2018-08-01v4No1 / 86
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ulva lactuca, ulva2018-08-01v4No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
196amnonlower in water compared to biofilm ( high in biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 100
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, north pacific ocean2017-04-17v4No1 / 103
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 103
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
587amnoncommon producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 106
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 113
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
196amnoncommon in biofilm in tap water (common water, drinking water, united states of america, biofilm)2017-09-12v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
355amnoncommon in upright gametophyte of mastocarpus algae (common canada, province of british columbia, calvert island, pacific ocean, ocean, alga, mastocarpus alaskensis, mastocarpus, upright gametophyte)2018-08-01v4No1 / 129
108amnoncommon research facility, texas, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
578amnoncommon control, sweden, kingdom of spain, homosexual, gay, msm, male, adult, feces, homo sapiens2020-01-14v3No1 / 132
578amnon high in kingdom of spain compared to sweden in homosexual gay msm male adult hiv infection feces homo sapiens 2020-01-14v3No1 / 133
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 146
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, oil seep, active methane seep2019-02-19v4No1 / 163
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, phylospadix, surfgrass2018-08-01v4No1 / 191
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth 5m, sea water)2017-04-18v4No1 / 214
587amnoncommon producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 215
108amnoncommon research facility, texas, united states of america, caecum, coturnix coturnix, common quail2017-04-07v4No1 / 216
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ptilota filicina, ptilota2018-08-01v4No1 / 230
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 237
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 254
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 255
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 264
309amnon high in other plants compared to meadow geranium geranium pratense in rhizosphere germany 2018-04-05v4No1 / 267
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
77amnon high in winter compared to summer in kelp forest marine biome algae australia 2017-02-28v4No1 / 303
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 345
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
583amnoncommon canton of graubunden, ph 4.5-7, siliceous parent material, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-27v3No1 / 359
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, low activity methane seep2019-02-19v4No1 / 371
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 399
309amnon high in other plants compared to germander speedwell veronica chamaedrys in rhizosphere germany 2018-04-05v4No1 / 404
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 419
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 444
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 461
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 465
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, egregia menziesii, egregia2018-08-01v4No1 / 472
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay msm homosexual compared to heterosexual msw in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 519
139amnonpositively correlated with sediment depth (in ocean floor depth 4000m) ( high in sediment depth 8-10cm compared to sediment depth 0-5cm in pacific ocean depth 4000m marine sediment )2017-04-18v4No1 / 522
357amnoncommon soil, topsoil, depth 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth 1000m)2017-04-18v4No1 / 566
138amnoncommon in ocean water depth 150-500m (common sea water, ocean, pacific ocean, depth 150-500m)2017-04-18v4No1 / 582
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 674
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
309amnon high in latyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
583amnoncommon ph 7-8, calcareous parent material, canton of graubunden, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-28v3No1 / 830
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
139amnoncommon pacific ocean, depth 4000m, marine sediment, polymetallic nodule2017-04-18v4No1 / 1196
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
515amnon high in detritivorous beetle bulgaria compared to herbivorous beetle poland in whole body beetle 2019-04-19v4No1 / 1543
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
137amnoncommon gopherus polyphemus, gopher tortoise, feces, united states of america, state of florida2017-04-17v4No1 / 1622
473amnon high in depth 50-100m compared to depth 5-50m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1656
138amnoncommon pacific ocean, depth 4000m, marine sediment2017-04-18v4No1 / 1753
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-19v4No1 / 1791
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org