Search result for sequence:
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCATTAACCTAATACGTTAGTGTTTTGACGTTACCGACAGAATAAGCACCGGC
common ontology terms
term enrichment score
TermScore
canada0.430769
african lion safari0.327273
food product type0.244898
captive0.220183
zoological garden0.180451
medicago sativa0.177778
alfalfa sprouts0.177778
sweden0.152866
child0.146597
producer c10.139535
age 2 years0.139535
producer c20.139535
toronto zoo0.139535
israel0.110092
age 7 years0.097561
indian flying fox0.097561
pteropus giganteus0.097561
mung bean sprouts0.097561
vigna radiata0.097561
age 7-14 years0.097561
age 6 months0.093023
shanghai proper0.093023
age 3 months0.088889
supragingival plaque0.088889
age 1 year0.078431
skin0.072351
saliva0.064343
farm0.063492
dentition0.057971
infant0.053333
LOWER IN age 7 years0.051282
age <1 year0.051282
fruit bat0.051282
eidolon helvum0.051282
reindeer0.051282
rangifer tarandus0.051282
eastern gray squirrel0.051282
sciurus carolinensis0.051282
canis lupus arctos0.051282
arctic wolf0.051282
bactrian camel0.051282
camelus bactrianus0.051282
asian elephant0.051282
elephas maximus0.051282
suckling0.051282
preweaned0.051282
age 2-4 weeks0.051282
LOWER IN weaned0.051282
LOWER IN corn and soybean diet0.051282
LOWER IN age 4-7 weeks0.051282
canton of graubunden0.051282
ph 4.5-70.051282
siliceous parent material0.051282
elevation 2000-3000m0.051282
red kangaroo0.051282
macropus rufus0.051282
orthic anthrosol0.051282
cucumis sativus0.051282
cucumber0.051282
LOWER IN age 1-7 years0.050000
cheetah0.050000
lion0.050000
panthera leo0.050000
giraffe0.050000
jiangxi province0.050000
mountain0.050000
acinonyx jubatus0.048780
giraffa camelopardalis0.048780
greenhouse soil0.048780
china0.048096
white rhinoceros0.047619
ceratotherium simum0.047619
switzerland0.046512
depth 0-10cm0.044444
LOWER IN saliva0.043478
pig0.043478
sus scrofa0.043478
dog0.040816
canis lupus familiaris0.037736
rhizosphere0.031250
homo sapiens0.022311
soil0.021978
feces0.007843
Fraction of dbbact annotations with this term covered by the query
TermScore
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
age 2 years0.500000
age 7 years0.500000
african lion safari0.500000
indian flying fox0.500000
pteropus giganteus0.500000
canada0.500000
producer c20.500000
LOWER IN age 7 years0.500000
mung bean sprouts0.500000
vigna radiata0.500000
age <1 year0.500000
toronto zoo0.500000
fruit bat0.500000
eidolon helvum0.500000
reindeer0.500000
rangifer tarandus0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
age 7-14 years0.500000
canis lupus arctos0.500000
arctic wolf0.500000
bactrian camel0.500000
camelus bactrianus0.500000
asian elephant0.500000
elephas maximus0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
canton of graubunden0.500000
ph 4.5-70.500000
siliceous parent material0.500000
elevation 2000-3000m0.500000
red kangaroo0.500000
macropus rufus0.500000
orthic anthrosol0.500000
cucumis sativus0.500000
cucumber0.500000
age 6 months0.333333
LOWER IN age 1-7 years0.333333
shanghai proper0.333333
cheetah0.333333
lion0.333333
panthera leo0.333333
giraffe0.333333
jiangxi province0.333333
mountain0.333333
age 3 months0.250000
supragingival plaque0.250000
acinonyx jubatus0.250000
giraffa camelopardalis0.250000
greenhouse soil0.250000
white rhinoceros0.200000
ceratotherium simum0.200000
captive0.166667
switzerland0.166667
age 1 year0.142857
zoological garden0.125000
depth 0-10cm0.125000
LOWER IN saliva0.111111
pig0.111111
sus scrofa0.111111
sweden0.100000
child0.090909
israel0.083333
dog0.083333
farm0.076923
canis lupus familiaris0.062500
dentition0.062500
infant0.052632
skin0.040000
rhizosphere0.037037
saliva0.035714
china0.030928
soil0.018519
homo sapiens0.011494
feces0.004587
Fraction of annotations for the query sequences containing the term
TermScore
child0.378378
homo sapiens0.378378
canada0.378378
skin0.378378
saliva0.324324
sweden0.324324
captive0.324324
zoological garden0.324324
african lion safari0.243243
food product type0.162162
israel0.162162
medicago sativa0.108108
alfalfa sprouts0.108108
china0.108108
producer c10.081081
age 2 years0.081081
producer c20.081081
toronto zoo0.081081
age 1 year0.054054
age 3 months0.054054
infant0.054054
age 6 months0.054054
age 7 years0.054054
indian flying fox0.054054
pteropus giganteus0.054054
mung bean sprouts0.054054
vigna radiata0.054054
shanghai proper0.054054
age 7-14 years0.054054
supragingival plaque0.054054
dentition0.054054
farm0.054054
LOWER IN age 7 years0.027027
LOWER IN age 1-7 years0.027027
age <1 year0.027027
fruit bat0.027027
eidolon helvum0.027027
dog0.027027
canis lupus familiaris0.027027
reindeer0.027027
rangifer tarandus0.027027
eastern gray squirrel0.027027
sciurus carolinensis0.027027
canis lupus arctos0.027027
arctic wolf0.027027
white rhinoceros0.027027
ceratotherium simum0.027027
bactrian camel0.027027
camelus bactrianus0.027027
cheetah0.027027
acinonyx jubatus0.027027
asian elephant0.027027
elephas maximus0.027027
lion0.027027
panthera leo0.027027
LOWER IN saliva0.027027
giraffe0.027027
giraffa camelopardalis0.027027
pig0.027027
sus scrofa0.027027
feces0.027027
jiangxi province0.027027
suckling0.027027
preweaned0.027027
age 2-4 weeks0.027027
LOWER IN weaned0.027027
LOWER IN corn and soybean diet0.027027
LOWER IN age 4-7 weeks0.027027
canton of graubunden0.027027
ph 4.5-70.027027
siliceous parent material0.027027
elevation 2000-3000m0.027027
depth 0-10cm0.027027
switzerland0.027027
mountain0.027027
soil0.027027
red kangaroo0.027027
macropus rufus0.027027
rhizosphere0.027027
greenhouse soil0.027027
orthic anthrosol0.027027
cucumis sativus0.027027
cucumber0.027027
Exp. ID User ID Description Date Region Flag Sequences
596amnondominant age 1 year, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 12
587amnondominant producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 12
596amnondominant age 3 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 14
596amnondominant age 2 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 14
596amnondominant infant, age 6 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 14
596amnondominant age 7 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 15
565amnondominant african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 20
596amnoncommon age 3 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 21
587amnondominant producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 23
596amnon high in age 2 years compared to age 7 years in child saliva sweden homo sapiens 2020-03-18v3No1 / 28
596amnoncommon infant, age 6 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 35
596amnoncommon age 1 year, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 36
587amnoncommon mung bean sprouts, vigna radiata, producer c1, food product type, israel2020-02-10v3No1 / 42
596amnoncommon age 2 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 57
596amnoncommon age 7 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 59
587amnoncommon producer c2, mung bean sprouts, vigna radiata, food product type, israel2020-02-10v3No1 / 67
596amnon high in age <1 year compared to age 1-7 years in child saliva sweden homo sapiens 2020-03-18v3No1 / 78
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
565amnoncommon dog, canis lupus familiaris, canada, skin2019-11-21v3No1 / 83
565amnoncommon african lion safari, reindeer, rangifer tarandus, zoological garden, captive, canada, skin2019-11-21v3No1 / 96
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
587amnoncommon producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 106
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
565amnoncommon canis lupus arctos, arctic wolf, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 114
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
565amnoncommon bactrian camel, camelus bactrianus, african lion safari, zoological garden, captive, canada, skin2019-11-21v3No1 / 122
565amnoncommon african lion safari, captive, zoological garden, canada, cheetah, acinonyx jubatus, skin2019-11-21v3No1 / 123
565amnoncommon asian elephant, elephas maximus, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 149
565amnoncommon toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 150
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
587amnoncommon producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 215
565amnoncommon giraffe, giraffa camelopardalis, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 310
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
583amnoncommon canton of graubunden, ph 4.5-7, siliceous parent material, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-27v3No1 / 359
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223

Problems / suggestions? Please email info AT dbbact DOT org