Search result for sequence:
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGTTGTAGATTAATACTCTGCAATTTTGACGTTACCGACAGAATAAGCACCGGC
common ontology terms
term enrichment score
TermScore
skin0.284360
united states of america0.211394
homo sapiens0.198363
china0.163034
river0.145794
water0.136954
fresh water0.131435
canada0.126316
adult0.121429
whole body0.102273
feces0.092450
kingdom of spain0.083799
beetle0.076923
mississippi river0.076621
child0.072993
israel0.072022
intestine0.071168
sweden0.066298
leaf0.065288
southern united states0.063953
soil0.063453
poland0.061972
snake0.061972
air0.060718
rhizosphere0.059219
frog0.057915
germany0.057225
larval stage0.056417
united kingdom0.054496
commonwealth of virginia0.053412
free floating0.053412
depth 1m0.052941
pair of nares0.052662
captive0.052356
zoological garden0.049751
mucus0.047337
food product type0.047337
state of rhode island0.047337
belgium0.046967
foodon product type0.046784
brazil0.046753
plant0.046602
infant0.046065
canis lupus familiaris0.045198
farm0.044004
filtered 0.2um0.042105
wheat0.042105
pyrenees0.041667
autumn0.041451
digestive system0.040336
winter0.040201
saliva0.040179
pond0.036810
research facility0.036577
lung0.036254
salamandra salamandra0.036254
carnivorous beetle0.035928
cambridgeshire0.035928
new york city0.035928
lower mississippi river0.035928
toronto zoo0.035928
depth 0-20cm0.035608
food (fermented)0.035503
newt0.035294
downstream0.034682
dog0.033520
sea water0.032832
particle0.030349
filtered 2.7um0.030349
mexico0.030272
raba river0.030120
nida basin0.030120
herbivorous beetle0.030120
fire salamander0.030120
french republic0.029970
amphibian larval stage0.029674
city0.029412
sus scrofa0.029028
pig0.029028
mouth0.028011
LOWER IN control0.026374
vitis vinifera0.024390
megaptera novaeangliae0.024390
humpback whale0.024390
fungus growing ant0.024242
costa rica0.024242
junco hyemalis0.024242
songbird0.024242
producer c10.024242
medicago sativa0.024242
alfalfa sprouts0.024242
mung bean sprouts0.024242
vigna radiata0.024242
producer c20.024242
biopsy0.024242
depth 10 cm0.024242
african lion safari0.024242
ivy0.024242
hedera ibernica0.024242
south korea0.024096
Fraction of dbbact annotations with this term covered by the query
TermScore
canada2.000000
pond1.500000
river0.750000
mississippi river0.750000
lung0.666667
vitis vinifera0.666667
salamandra salamandra0.666667
stream0.666667
particle0.666667
filtered 2.7um0.666667
filtered 0.2um0.666667
seed0.666667
megaptera novaeangliae0.666667
humpback whale0.666667
salamander0.666667
day 00.666667
LOWER IN nasopharynx0.666667
jiangxi province0.666667
wheat0.666667
skin0.600000
whole body0.600000
commonwealth of virginia0.600000
mexico0.600000
free floating0.600000
fresh water0.555556
coffea arabica0.500000
LOWER IN start0.500000
endosphere0.500000
fungus growing ant0.500000
atta sexdens0.500000
irritable bowel syndrome0.500000
costa rica0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
carnivorous beetle0.500000
raba river0.500000
paederus riparius0.500000
lissotriton vulgaris0.500000
cambridgeshire0.500000
triturus cristatus0.500000
mucus0.500000
anaxyrus americanus0.500000
american toad0.500000
pet0.500000
serinus canaria0.500000
canary0.500000
annona cherimola0.500000
ceratitis capitata0.500000
mediterranean fruit fly0.500000
fiji0.500000
junco hyemalis0.500000
songbird0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
fire salamander0.500000
bufo bufo0.500000
common toad0.500000
human0.500000
new york city0.500000
skin under eye0.500000
LOWER IN conjunctiva0.500000
skin of face0.500000
skin under eyes0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
leaf interior0.500000
middle ear0.500000
acute transudative otitis media0.500000
state of rhode island0.500000
scallion0.500000
mycocepurus smithii0.500000
pyrenees0.500000
contact lens0.500000
hordeum vulgare0.500000
winter barley0.500000
cloud0.500000
ficus carica0.500000
fig0.500000
prunus persica0.500000
peach0.500000
lapland0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
aphodius sphacelatus0.500000
mung bean sprouts0.500000
vigna radiata0.500000
apple0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.251553
homo sapiens0.195652
skin0.186335
china0.124224
adult0.105590
feces0.093168
water0.090062
river0.080745
fresh water0.074534
canada0.065217
whole body0.055901
kingdom of spain0.046584
beetle0.043478
child0.043478
intestine0.040373
israel0.040373
mississippi river0.040373
soil0.040373
leaf0.037267
sweden0.037267
poland0.034161
air0.034161
rhizosphere0.034161
snake0.034161
southern united states0.034161
frog0.031056
united kingdom0.031056
larval stage0.031056
germany0.031056
captive0.031056
zoological garden0.031056
commonwealth of virginia0.027950
depth 1m0.027950
free floating0.027950
saliva0.027950
brazil0.027950
pair of nares0.027950
canis lupus familiaris0.024845
digestive system0.024845
mucus0.024845
infant0.024845
plant0.024845
food product type0.024845
state of rhode island0.024845
foodon product type0.024845
research facility0.024845
belgium0.024845
farm0.024845
pyrenees0.021739
winter0.021739
autumn0.021739
filtered 0.2um0.021739
wheat0.021739
lung0.018634
dog0.018634
LOWER IN control0.018634
carnivorous beetle0.018634
newt0.018634
cambridgeshire0.018634
salamandra salamandra0.018634
new york city0.018634
downstream0.018634
lower mississippi river0.018634
food (fermented)0.018634
pond0.018634
sea water0.018634
toronto zoo0.018634
depth 0-20cm0.018634
raba river0.015528
mexico0.015528
nida basin0.015528
herbivorous beetle0.015528
fire salamander0.015528
amphibian larval stage0.015528
french republic0.015528
particle0.015528
filtered 2.7um0.015528
mouth0.015528
sus scrofa0.015528
pig0.015528
city0.015528
control0.015528
state of california0.012422
vitis vinifera0.012422
panama0.012422
fungus growing ant0.012422
costa rica0.012422
bird0.012422
body proper0.012422
italy0.012422
nasopharynx0.012422
junco hyemalis0.012422
songbird0.012422
producer c10.012422
medicago sativa0.012422
alfalfa sprouts0.012422
mung bean sprouts0.012422
vigna radiata0.012422
south korea0.012422
producer c20.012422
Exp. ID User ID Description Date Region Flag Sequences
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
67amnonincreases during fermentation of coffee beans ( high in end compared to start in coffea arabica ecuador )2017-02-19v4No1 / 3
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
189amnondominant united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
231amnonhigh freq. in dog urine (dominant dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 6
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
374amnondominant skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 9
423amnondominant bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 9
515amnondominant poland, whole body, beetle, carnivorous beetle, river, raba river, paederus riparius2019-04-18v4No1 / 9
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
99amnondominant commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 11
302amnonhigh freq. in feces of canary pet birds (dominant bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 11
346amnoncommon in fruitfly larva grown on annona (common larval stage, body proper, italy, whole body, annona cherimola, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 11
533amnoncommon homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 11
89amnondominant junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 12
231amnonhigh freq. in dog genitalia (dominant dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 12
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
533amnondominant homo sapiens, infant, age 1 year, nasopharynx, fiji2019-07-22v4No1 / 12
587amnondominant producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 12
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 13
492amnondominant skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 13
58amnon high in skin skin under eye compared to conjunctiva in human new york city 2017-02-02v4No1 / 14
58amnondominant homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 14
89amnondominant junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 14
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 14
311amnondominant united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
403amnondominant air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 14
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
126amnondominant rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant cloud, french republic, air, autumn)2017-11-22v4No1 / 15
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, italy, whole body, peach, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
511amnondominant snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 15
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 15
587amnondominant mung bean sprouts, vigna radiata, producer c1, food product type, israel2020-02-10v3No1 / 15
343amnonhigh freq. in apple flowers (dominant apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 16
397amnondominant panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
443amnondominant mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 16
536amnondominant crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 16
37amnondominant maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 17
90amnondominant douchi, china, food (fermented)2017-03-08v4No1 / 17
443amnondominant mississippi river, water, river, fresh water, depth 1m, united states of america, free floating, filtered 0.2um, uppper mississippi river, upstream2019-01-07v4No1 / 17
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
174amnonhigh freq. in debris covered glacier (dominant alaska, united states of america, denali national park and preserve, glacier, surface, debris)2017-07-27v4No1 / 19
178amnonhigh freq. in drinking water pipes biofilm (dominant kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 19
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 19
492amnondominant skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
58amnoncommon homo sapiens, new york city, skin of face, skin under eyes2017-02-02v4No1 / 21
596amnoncommon age 3 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 21
403amnondominant air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 22
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus riparius2019-04-18v4No1 / 22
593amnondominant osteoarthritis, south korea, adult, feces, homo sapiens2020-03-08v3No1 / 22
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 23
587amnondominant producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 23
587amnondominant producer c2, mung bean sprouts, vigna radiata, food product type, israel2020-02-10v3No1 / 23
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 26
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
596amnon high in age 2 years compared to age 7 years in child saliva sweden homo sapiens 2020-03-18v3No1 / 28
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi china food (fermented) )2017-03-08v4No1 / 30
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 30
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 31
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 32
37amnoncommon maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 33
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 35
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v4No1 / 35
596amnoncommon infant, age 6 months, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 35
403amnoncommon air, kingdom of spain, pyrenees, autumn2018-11-18v4No1 / 36
596amnoncommon age 1 year, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
275amnonhigher in fall 2010 compared to summer 2013 in whale skin ( high in autumn compared to summer in megaptera novaeangliae humpback whale antarctica antarctic peninsula skin )2018-01-16v4No1 / 42
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
564amnoncommon autistic disorder, feces, italy, age 2-4 years, child, homo sapiens2019-11-18v3No1 / 42
587amnoncommon mung bean sprouts, vigna radiata, producer c1, food product type, israel2020-02-10v3No1 / 42
595amnoncommon switzerland, whole body, castor bean tick, ixodes ricinus2020-03-16v4No1 / 42
89amnoncommon junco hyemalis, uropygial gland, commonwealth of virginia, songbird2017-03-08v4No1 / 43
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
89amnoncommon junco hyemalis, commonwealth of virginia, songbird, cloaca2017-03-08v4No1 / 48
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 53
408amnon high in pseudomyrmex spinicola acacia ants pseudomyrmex nigrocinctus pseudomyrmex flavicornis compared to pseudomyrmex gracilis generalist in ant costa rica united states of america pseudomyrmex 2018-11-22v4No1 / 53
578amnoncommon hiv infection, heterosexual, msw, sweden, kingdom of spain, male, adult, feces, homo sapiens2020-01-14v3No1 / 53
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
596amnoncommon age 2 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 57
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
596amnoncommon age 7 years, child, saliva, sweden, homo sapiens2020-03-17v3No1 / 59
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
403amnon high in summer compared to winter in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 67
587amnoncommon producer c2, mung bean sprouts, vigna radiata, food product type, israel2020-02-10v3No1 / 67
574amnoncommon adult, russia, homo sapiens, feces2020-01-05v3No1 / 68
593amnoncommon osteoarthritis, south korea, adult, feces, homo sapiens2020-03-08v3No1 / 68
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
569amnoncommon in gastric biopsies of patients positive for h. pylori (common helicobacter pylori infectious disease, biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 77
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
596amnon high in age <1 year compared to age 1-7 years in child saliva sweden homo sapiens 2020-03-18v3No1 / 78
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 83
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
565amnoncommon dog, canis lupus familiaris, canada, skin2019-11-21v3No1 / 83
565amnoncommon captive, toronto zoo, zoological garden, fruit bat, eidolon helvum, canada, skin2019-11-21v3No1 / 83
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
569amnoncommon in gastric biopsies of patients negative for h. pylori (common biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 85
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
578amnoncommon heterosexual, msw, control, sweden, kingdom of spain, male, adult, feces, homo sapiens2020-01-14v3No1 / 92
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 106
587amnoncommon producer c1, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
565amnoncommon african lion safari, captive, zoological garden, indian flying fox, pteropus giganteus, canada, skin2019-11-21v3No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
565amnoncommon wild horse, equus przewalskii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 112
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
565amnoncommon canis lupus arctos, arctic wolf, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 114
567amnon high in control compared to sinusitis chronic rhinosinusitis in nasopharynx belgium adult homo sapiens 2019-12-05v4No1 / 114
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
565amnoncommon white rhinoceros, ceratotherium simum, african lion safari, captive, zoological garden, canada, skin2019-11-21v3No1 / 122
565amnoncommon african lion safari, captive, zoological garden, canada, cheetah, acinonyx jubatus, skin2019-11-21v3No1 / 123
427amnoncommon united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v4No1 / 125
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 40m2019-09-14v3No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
578amnon high in kingdom of spain compared to sweden in homosexual gay msm male adult hiv infection feces homo sapiens 2020-01-14v3No1 / 133
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
565amnoncommon toronto zoo, zoological garden, lion, panthera leo, captive, canada, skin2019-11-21v3No1 / 150
273amnon high in age age one month compared to age one year in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
206amnonhigher in dust storm compared to clear day in israel air ( high in clear day compared to dust day in israel air dust size < 10um )2017-10-04v4No1 / 173
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
567amnon high in control compared to chronic rhinosinusitis sinusitis in pair of nares anterior naris belgium adult homo sapiens 2019-12-05v4No1 / 191
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 193
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 201
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, uppper mississippi river, upstream, particle, filtered 2.7um2019-01-07v4No1 / 201
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
587amnoncommon producer c2, medicago sativa, alfalfa sprouts, food product type, israel2020-02-10v3No1 / 215
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, free floating, filtered 0.2um, uppper mississippi river, upstream2019-01-07v4No1 / 219
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to msm gay homosexual in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 220
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
357amnon high in ph<4 compared to ph>4 in soil topsoil depth 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 282
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
174amnoncommon in debris covered glacier (common alaska, united states of america, denali national park and preserve, glacier, surface, debris)2017-07-27v4No1 / 294
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in alaska united states of america denali national park and preserve glacier surface debris )2017-07-27v4No1 / 310
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
565amnoncommon farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in urocyon littoralis catalinae santa catalina island fox urocyon littoralis santa catalina island united states of america wild 2020-01-22v4No1 / 374
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 525
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 623
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particle in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 653
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
565amnoncommon toronto zoo, eland, tragelaphus oryx, captive, zoological garden, canada, skin2019-11-21v3No1 / 674
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 693
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
454amnon high in winter compared to summer in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1304
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnon high in root compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 2075
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org