Search result for sequence:
TGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA
common ontology terms
term enrichment score
TermScore
agricultural field0.262295
ph 70.231884
elevation 2000-3000m0.210526
wheat0.207792
canada0.190476
mountain0.190476
triticum aestivum0.188235
kingdom of denmark0.158416
siliceous parent material0.150943
canton of graubunden0.150943
high biochar0.150943
peromyscus maniculatus0.150943
deer mice0.150943
province of ontario0.150943
algonquin provincial park0.150943
janvier labs0.150943
guizhou province0.150943
kaiyang county0.150943
maize field0.150943
switzerland0.148148
sugarcane0.140351
saccharum0.140351
guangzhou city prefecture0.140351
age 3-5 weeks0.140351
depth 0-10cm0.129032
farm0.125000
ph 6.70.117647
bile0.117647
gallbladder0.117647
age 18 weeks0.117647
high sugar diet0.117647
pomacea canaliculata0.117647
golden apple snail0.117647
nanheng river0.117647
qingpu district0.117647
after 6 years0.117647
kingdom of spain0.112676
soil0.112388
non-fertilized soil0.111111
topsoil0.109589
depth 0-20cm0.109589
china0.095781
c57bl/6j0.094118
germany0.082474
rhone river valley0.081633
ph 4.5-70.081633
calcareous parent material0.081633
low biochar0.081633
straw0.081633
cow milk (raw)0.081633
cow milk (fluid)0.081633
milk0.081633
romania0.081633
ursu lake0.081633
depth 4-9m0.081633
hypersaline water0.081633
monimolimnion0.081633
ph 4-60.078431
lake water0.078431
high salinity0.078431
unamended soil0.078431
bulk soil0.075472
lake0.070175
ph 7-80.067797
biochar0.067797
rhizosphere0.063492
wild0.062500
italy0.059701
LOWER IN cholelithiasis0.042553
LOWER IN very high sugar diet0.042553
LOWER IN age 6 weeks0.042553
buccal mass0.042553
alpine pasture0.042553
alpine0.042553
lowland pasture0.042553
lowland farm0.042553
equus asinus africanus0.042553
donkey0.042553
LOWER IN depth 0-3m0.042553
LOWER IN mixolimnion0.042553
LOWER IN ph 5.5-60.042553
baijiu0.042553
hefei city prefecture0.042553
days 0-900.042553
LOWER IN preweaned0.042553
LOWER IN suckling0.042553
LOWER IN age 2-4 weeks0.042553
weaned0.042553
age 4-7 weeks0.042553
corn and soybean diet0.042553
orthic anthrosol0.042553
cucumis sativus0.042553
cucumber0.042553
ph 7.850.042553
ph 7.60.042553
ph 5.5-60.042553
ph 7.90.042553
ph 80.042553
LOWER IN western diet0.041667
age 6 weeks0.041667
Fraction of dbbact annotations with this term covered by the query
TermScore
canada0.666667
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
ph 6.70.500000
agricultural field0.500000
high biochar0.500000
low biochar0.500000
peromyscus maniculatus0.500000
deer mice0.500000
province of ontario0.500000
algonquin provincial park0.500000
straw0.500000
bile0.500000
gallbladder0.500000
LOWER IN cholelithiasis0.500000
janvier labs0.500000
age 18 weeks0.500000
high sugar diet0.500000
LOWER IN very high sugar diet0.500000
LOWER IN age 6 weeks0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
qingpu district0.500000
buccal mass0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
lowland pasture0.500000
lowland farm0.500000
romania0.500000
ursu lake0.500000
depth 4-9m0.500000
hypersaline water0.500000
monimolimnion0.500000
equus asinus africanus0.500000
donkey0.500000
LOWER IN depth 0-3m0.500000
LOWER IN mixolimnion0.500000
LOWER IN ph 5.5-60.500000
baijiu0.500000
hefei city prefecture0.500000
days 0-900.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
orthic anthrosol0.500000
cucumis sativus0.500000
cucumber0.500000
ph 7.850.500000
guizhou province0.500000
kaiyang county0.500000
maize field0.500000
after 6 years0.500000
ph 7.60.500000
ph 5.5-60.500000
ph 7.90.500000
ph 80.500000
mountain0.333333
ph 4-60.333333
sugarcane0.333333
saccharum0.333333
guangzhou city prefecture0.333333
non-fertilized soil0.333333
ph 70.333333
age 3-5 weeks0.333333
LOWER IN western diet0.333333
age 6 weeks0.333333
lake water0.333333
high salinity0.333333
LOWER IN low salinity0.333333
LOWER IN fertilized soil0.333333
mud0.333333
fermentation pit mud0.333333
jiangxi province0.333333
unamended soil0.333333
fertilized soil0.333333
wheat0.250000
LOWER IN captive0.250000
gay0.250000
greenhouse soil0.250000
bulk soil0.250000
triticum aestivum0.200000
LOWER IN research facility0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
switzerland0.166667
lake0.166667
homosexual0.166667
msm0.166667
kingdom of spain0.153846
Fraction of annotations for the query sequences containing the term
TermScore
soil0.488889
china0.311111
feces0.222222
agricultural field0.177778
kingdom of denmark0.177778
wheat0.177778
ph 70.177778
triticum aestivum0.177778
mountain0.133333
switzerland0.133333
depth 0-10cm0.133333
elevation 2000-3000m0.133333
canada0.111111
research facility0.111111
farm0.111111
siliceous parent material0.088889
canton of graubunden0.088889
sugarcane0.088889
saccharum0.088889
topsoil0.088889
depth 0-20cm0.088889
guangzhou city prefecture0.088889
high biochar0.088889
peromyscus maniculatus0.088889
deer mice0.088889
age 3-5 weeks0.088889
province of ontario0.088889
algonquin provincial park0.088889
kingdom of spain0.088889
adult0.088889
homo sapiens0.088889
mouse0.088889
mus musculus0.088889
germany0.088889
female0.088889
c57bl/6j0.088889
janvier labs0.088889
guizhou province0.088889
kaiyang county0.088889
maize field0.088889
ph 6.70.066667
non-fertilized soil0.066667
wild0.066667
control0.066667
bile0.066667
gallbladder0.066667
age 18 weeks0.066667
high sugar diet0.066667
pomacea canaliculata0.066667
golden apple snail0.066667
nanheng river0.066667
qingpu district0.066667
rhizosphere0.066667
after 6 years0.066667
ph 4-60.044444
rhone river valley0.044444
ph 4.5-70.044444
calcareous parent material0.044444
ph 7-80.044444
low biochar0.044444
straw0.044444
italy0.044444
cow milk (raw)0.044444
cow milk (fluid)0.044444
milk0.044444
lake0.044444
romania0.044444
ursu lake0.044444
water0.044444
lake water0.044444
depth 4-9m0.044444
high salinity0.044444
hypersaline water0.044444
monimolimnion0.044444
biochar0.044444
unamended soil0.044444
bulk soil0.044444
LOWER IN cholelithiasis0.022222
LOWER IN western diet0.022222
LOWER IN very high sugar diet0.022222
LOWER IN high fat diet0.022222
LOWER IN age 6 weeks0.022222
LOWER IN mouse chow0.022222
captive0.022222
age 6 weeks0.022222
mouse chow0.022222
buccal mass0.022222
alpine pasture0.022222
alpine0.022222
stomach0.022222
intestine0.022222
lowland pasture0.022222
lowland farm0.022222
skin0.022222
equus asinus africanus0.022222
donkey0.022222
LOWER IN captive0.022222
LOWER IN research facility0.022222
LOWER IN depth 0-3m0.022222
LOWER IN mixolimnion0.022222
Exp. ID User ID Description Date Region Flag Sequences
583amnondominant soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 2
583amnondominant soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-28v3No1 / 2
583amnondominant soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 2
616amnondominant in topsoil of non-fertilized sugarcane field (dominant ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 6
610sheryoDominant in agricultural field soil (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, triticum aestivum)2020-04-21v3No1 / 8
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, low biochar)2020-04-21v3No1 / 9
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, straw)2020-04-21v3No1 / 10
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
583amnoncommon soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
577amnoncommon lake, romania, ursu lake, water, lake water, depth 4-9m, high salinity, hypersaline water, monimolimnion2020-01-09v3No1 / 303
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 335
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 439
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in sugarcane saccharum soil topsoil depth 0-20cm china guangzhou city prefecture 2020-04-27v3No1 / 504
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872

Problems / suggestions? Please email info AT dbbact DOT org