Search result for sequence:
TGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA
common ontology terms
term enrichment score
TermScore
canada0.322581
elevation 2000-3000m0.315789
mountain0.272727
canton of graubunden0.235294
siliceous parent material0.235294
peromyscus maniculatus0.235294
deer mice0.235294
province of ontario0.235294
algonquin provincial park0.235294
janvier labs0.235294
age 3-5 weeks0.210526
switzerland0.193548
bile0.187500
gallbladder0.187500
age 18 weeks0.187500
high sugar diet0.187500
qingpu district0.187500
nanheng river0.187500
golden apple snail0.187500
pomacea canaliculata0.187500
depth 0-10cm0.162162
kingdom of spain0.160000
calcareous parent material0.133333
ph 4.5-70.133333
rhone river valley0.133333
monimolimnion0.133333
hypersaline water0.133333
depth 4-9m0.133333
ursu lake0.133333
romania0.133333
ph 4-60.125000
high salinity0.125000
lake water0.125000
c57bl/6j0.121212
farm0.115385
germany0.114286
ph 7-80.111111
lake0.105263
wild0.088235
LOWER IN cholelithiasis0.071429
LOWER IN very high sugar diet0.071429
LOWER IN age 6 weeks0.071429
buccal mass0.071429
donkey0.071429
equus asinus africanus0.071429
LOWER IN mixolimnion0.071429
LOWER IN depth 0-3m0.071429
LOWER IN preweaned0.071429
LOWER IN suckling0.071429
LOWER IN age 2-4 weeks0.071429
weaned0.071429
age 4-7 weeks0.071429
corn and soybean diet0.071429
orthic anthrosol0.071429
cucumis sativus0.071429
cucumber0.071429
LOWER IN western diet0.068966
age 6 weeks0.068966
LOWER IN low salinity0.068966
jiangxi province0.068966
LOWER IN captive0.066667
LOWER IN research facility0.066667
LOWER IN heterosexual0.066667
LOWER IN msw0.066667
gay0.066667
greenhouse soil0.066667
msm0.064516
homosexual0.064516
captive0.062500
male0.060606
hiv infection0.058824
pig0.057143
sus scrofa0.057143
sweden0.055556
LOWER IN high fat diet0.054054
mouse chow0.054054
china0.053286
LOWER IN mouse chow0.051282
stomach0.050000
female0.048193
intestine0.043478
skin0.039216
adult0.038462
rhizosphere0.037736
research facility0.035907
mouse0.035398
feces0.035026
soil0.034286
water0.032258
mus musculus0.031496
homo sapiens0.021390
control0.014019
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
calcareous parent material0.500000
canton of graubunden0.500000
elevation 2000-3000m0.500000
ph 4.5-70.500000
siliceous parent material0.500000
rhone river valley0.500000
peromyscus maniculatus0.500000
deer mice0.500000
province of ontario0.500000
algonquin provincial park0.500000
bile0.500000
gallbladder0.500000
LOWER IN cholelithiasis0.500000
janvier labs0.500000
age 18 weeks0.500000
high sugar diet0.500000
LOWER IN very high sugar diet0.500000
LOWER IN age 6 weeks0.500000
buccal mass0.500000
qingpu district0.500000
nanheng river0.500000
golden apple snail0.500000
pomacea canaliculata0.500000
monimolimnion0.500000
hypersaline water0.500000
depth 4-9m0.500000
ursu lake0.500000
romania0.500000
donkey0.500000
equus asinus africanus0.500000
LOWER IN mixolimnion0.500000
LOWER IN depth 0-3m0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
orthic anthrosol0.500000
cucumis sativus0.500000
cucumber0.500000
mountain0.333333
ph 4-60.333333
age 3-5 weeks0.333333
LOWER IN western diet0.333333
age 6 weeks0.333333
high salinity0.333333
lake water0.333333
LOWER IN low salinity0.333333
jiangxi province0.333333
LOWER IN captive0.250000
LOWER IN research facility0.250000
LOWER IN heterosexual0.250000
LOWER IN msw0.250000
gay0.250000
greenhouse soil0.250000
ph 7-80.200000
msm0.200000
homosexual0.200000
switzerland0.166667
kingdom of spain0.166667
captive0.166667
lake0.166667
male0.142857
depth 0-10cm0.125000
hiv infection0.125000
farm0.115385
pig0.111111
sus scrofa0.111111
c57bl/6j0.100000
sweden0.100000
germany0.090909
LOWER IN high fat diet0.090909
mouse chow0.090909
LOWER IN mouse chow0.076923
wild0.071429
stomach0.071429
intestine0.050000
skin0.040000
rhizosphere0.037037
china0.030928
female0.028571
adult0.021978
water0.020408
mouse0.020000
research facility0.019802
soil0.018519
feces0.018349
mus musculus0.017544
homo sapiens0.011494
control0.007463
Fraction of annotations for the query sequences containing the term
TermScore
feces0.384615
elevation 2000-3000m0.230769
depth 0-10cm0.230769
switzerland0.230769
mountain0.230769
soil0.230769
canada0.192308
research facility0.192308
china0.192308
canton of graubunden0.153846
siliceous parent material0.153846
peromyscus maniculatus0.153846
deer mice0.153846
age 3-5 weeks0.153846
province of ontario0.153846
algonquin provincial park0.153846
kingdom of spain0.153846
adult0.153846
homo sapiens0.153846
mouse0.153846
mus musculus0.153846
germany0.153846
female0.153846
c57bl/6j0.153846
janvier labs0.153846
wild0.115385
control0.115385
bile0.115385
gallbladder0.115385
age 18 weeks0.115385
high sugar diet0.115385
qingpu district0.115385
nanheng river0.115385
golden apple snail0.115385
pomacea canaliculata0.115385
farm0.115385
ph 7-80.076923
calcareous parent material0.076923
ph 4.5-70.076923
rhone river valley0.076923
ph 4-60.076923
monimolimnion0.076923
hypersaline water0.076923
high salinity0.076923
depth 4-9m0.076923
lake water0.076923
water0.076923
ursu lake0.076923
romania0.076923
lake0.076923
LOWER IN cholelithiasis0.038462
LOWER IN western diet0.038462
LOWER IN very high sugar diet0.038462
LOWER IN high fat diet0.038462
LOWER IN age 6 weeks0.038462
LOWER IN mouse chow0.038462
captive0.038462
age 6 weeks0.038462
mouse chow0.038462
buccal mass0.038462
stomach0.038462
intestine0.038462
donkey0.038462
equus asinus africanus0.038462
skin0.038462
LOWER IN captive0.038462
LOWER IN research facility0.038462
LOWER IN low salinity0.038462
LOWER IN mixolimnion0.038462
LOWER IN depth 0-3m0.038462
LOWER IN heterosexual0.038462
LOWER IN msw0.038462
gay0.038462
msm0.038462
homosexual0.038462
male0.038462
sweden0.038462
hiv infection0.038462
pig0.038462
sus scrofa0.038462
jiangxi province0.038462
LOWER IN preweaned0.038462
LOWER IN suckling0.038462
LOWER IN age 2-4 weeks0.038462
weaned0.038462
age 4-7 weeks0.038462
corn and soybean diet0.038462
rhizosphere0.038462
greenhouse soil0.038462
orthic anthrosol0.038462
cucumis sativus0.038462
cucumber0.038462
Exp. ID User ID Description Date Region Flag Sequences
583amnondominant ph 7-8, calcareous parent material, canton of graubunden, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-28v3No1 / 2
583amnondominant canton of graubunden, ph 4.5-7, siliceous parent material, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-28v3No1 / 2
583amnondominant rhone river valley, siliceous parent material, elevation 2000-3000m, depth 0-10cm, ph 4-6, switzerland, mountain, soil2020-01-27v3No1 / 2
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
585amnoncommon buccal mass, qingpu district, nanheng river, golden apple snail, pomacea canaliculata, china2020-02-02v3No1 / 136
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
585amnoncommon stomach, qingpu district, nanheng river, golden apple snail, pomacea canaliculata, china2020-02-02v3No1 / 194
583amnoncommon rhone river valley, siliceous parent material, elevation 2000-3000m, depth 0-10cm, ph 4-6, switzerland, mountain, soil2020-01-27v3No1 / 234
585amnoncommon intestine, qingpu district, nanheng river, golden apple snail, pomacea canaliculata, china2020-02-02v3No1 / 240
577amnoncommon monimolimnion, hypersaline water, high salinity, depth 4-9m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 303
565amnoncommon farm, donkey, equus asinus africanus, canada, skin2019-11-21v3No1 / 335
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
583amnoncommon canton of graubunden, ph 4.5-7, siliceous parent material, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-27v3No1 / 359
577amnon high in monimolimnion depth 4-9m high salinity hypersaline water compared to low salinity mixolimnion depth 0-3m in lake water water ursu lake romania lake 2020-01-09v3No1 / 439
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay msm homosexual compared to heterosexual msw in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 519
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
583amnoncommon ph 7-8, calcareous parent material, canton of graubunden, elevation 2000-3000m, depth 0-10cm, switzerland, mountain, soil2020-01-28v3No1 / 830
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223

Problems / suggestions? Please email info AT dbbact DOT org