Search result for sequence:
TGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCGATAACGGAAGAAGATGACAAGCCGTTAAGGAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGG
common ontology terms
term enrichment score
TermScore
supragingival plaque0.533333
late adult stage0.461538
age 7-14 years0.461538
shanghai proper0.375000
LOWER IN saliva0.250000
lower labial mucosa0.222222
dentition0.216216
aphthous stomatitis0.200000
lip0.200000
mouth mucosa0.181818
czech republic0.142857
saliva0.125000
city0.103448
child0.089552
adult0.045198
china0.041096
homo sapiens0.035294
LOWER IN control0.014706
Fraction of dbbact annotations with this term covered by the query
TermScore
lower labial mucosa0.500000
late adult stage0.500000
supragingival plaque0.500000
age 7-14 years0.500000
aphthous stomatitis0.333333
lip0.333333
shanghai proper0.333333
mouth mucosa0.250000
LOWER IN saliva0.222222
czech republic0.142857
dentition0.133333
saliva0.080000
city0.058824
child0.050000
adult0.023529
china0.021053
homo sapiens0.017964
LOWER IN control0.007752
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
china0.857143
adult0.571429
dentition0.571429
supragingival plaque0.571429
late adult stage0.428571
city0.428571
shanghai proper0.428571
child0.428571
age 7-14 years0.428571
LOWER IN saliva0.285714
saliva0.285714
LOWER IN control0.142857
lower labial mucosa0.142857
aphthous stomatitis0.142857
mouth mucosa0.142857
lip0.142857
czech republic0.142857

Problems / suggestions? Please email info AT dbbact DOT org