Search result for sequence:
TGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCGATAACGGAAGAAGATGACAAGCCGTTAAGGAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGG
common ontology terms
term enrichment score
TermScore
supragingival plaque0.590604
supragingival dental plaque0.437500
age 6 years0.357143
age 8 years0.357143
age 9 years0.357143
age 11 years0.357143
dentition0.313167
age 7 years0.303030
age 10 years0.303030
state of nebraska0.263158
child0.256410
age 20-30 years0.250000
late adult stage0.250000
age 7-14 years0.250000
saliva0.240000
canada0.222222
toronto0.222222
shanghai proper0.222222
LOWER IN saliva0.206897
LOWER IN dermal layer of tongue0.181818
burmese0.181818
asian0.166667
LOWER IN tongue0.153846
lower labial mucosa0.100000
teeth braces0.100000
braces0.100000
age 13-15 years0.100000
hispanic0.100000
lip0.095238
aphthous stomatitis0.095238
european0.095238
hispanic or latin american0.095238
LOWER IN european0.095238
age 1-7 years0.095238
mouth mucosa0.090909
caucasian0.090909
african american0.090909
LOWER IN caucasian0.090909
LOWER IN age < 1 year0.086957
city0.083333
czech republic0.080000
oral cavity0.080000
sichuan province0.080000
homo sapiens0.079208
sweden0.071429
adult0.067797
kingdom of spain0.064516
china0.050971
LOWER IN control0.024845
united states of america0.009407
Fraction of dbbact annotations with this term covered by the query
TermScore
supragingival plaque0.571429
lower labial mucosa0.500000
LOWER IN dermal layer of tongue0.500000
age 20-30 years0.500000
late adult stage0.500000
teeth braces0.500000
braces0.500000
age 13-15 years0.500000
supragingival dental plaque0.500000
age 6 years0.500000
age 8 years0.500000
age 9 years0.500000
age 11 years0.500000
hispanic0.500000
age 7-14 years0.500000
burmese0.500000
lip0.333333
aphthous stomatitis0.333333
canada0.333333
toronto0.333333
european0.333333
age 7 years0.333333
age 10 years0.333333
hispanic or latin american0.333333
shanghai proper0.333333
asian0.333333
LOWER IN european0.333333
age 1-7 years0.333333
LOWER IN saliva0.272727
mouth mucosa0.250000
LOWER IN tongue0.250000
caucasian0.250000
state of nebraska0.250000
african american0.250000
LOWER IN caucasian0.250000
dentition0.210526
LOWER IN age < 1 year0.200000
saliva0.187500
child0.166667
czech republic0.142857
oral cavity0.142857
sichuan province0.142857
sweden0.100000
kingdom of spain0.076923
city0.055556
homo sapiens0.041237
adult0.036697
china0.027273
LOWER IN control0.013986
united states of america0.004785
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
dentition0.611111
supragingival plaque0.611111
child0.555556
adult0.444444
china0.388889
supragingival dental plaque0.388889
saliva0.333333
united states of america0.277778
state of nebraska0.277778
age 6 years0.277778
age 7 years0.277778
age 8 years0.277778
age 9 years0.277778
age 10 years0.277778
age 11 years0.277778
canada0.166667
toronto0.166667
age 20-30 years0.166667
late adult stage0.166667
city0.166667
LOWER IN saliva0.166667
shanghai proper0.166667
age 7-14 years0.166667
LOWER IN control0.111111
LOWER IN tongue0.111111
LOWER IN dermal layer of tongue0.111111
asian0.111111
burmese0.111111
czech republic0.055556
lip0.055556
mouth mucosa0.055556
aphthous stomatitis0.055556
lower labial mucosa0.055556
teeth braces0.055556
braces0.055556
age 13-15 years0.055556
kingdom of spain0.055556
oral cavity0.055556
european0.055556
caucasian0.055556
hispanic or latin american0.055556
hispanic0.055556
african american0.055556
sichuan province0.055556
LOWER IN european0.055556
LOWER IN caucasian0.055556
sweden0.055556
age 1-7 years0.055556
LOWER IN age < 1 year0.055556
Exp. ID User ID Description Date Region Flag Sequences
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 10
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 55
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 56
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 79
658amnoncommon european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 82
658amnoncommon hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 93
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
658amnoncommon african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 98
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
658amnoncommon asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska, age 6 years, age 7 years, age 8 years, age 9 years, age 10 years, age 11 years2020-09-17v3No1 / 157
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 157
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 205
658amnon high in asian burmese compared to european caucasian in homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska age 6 years age 7 years age 8 years age 9 years age 10 years age 11 years 2020-09-17v3No1 / 212
596amnon high in age 1-7 years compared to age < 1 year in homo sapiens sweden saliva child 2020-03-18v3No1 / 288

Problems / suggestions? Please email info AT dbbact DOT org