Search result for sequence:
TGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.524761
dentition0.322148
mouth0.294887
adult0.281677
subgingival plaque0.258065
child0.237624
feces0.216793
infant0.137931
china0.135593
brazil0.133333
obsolete_juvenile stage0.113636
saliva0.113111
united states of america0.107262
supragingival plaque0.096000
australia0.092664
czech republic0.091603
mouth mucosa0.084677
age < 3 years0.084084
finland0.083210
crohn's disease0.083037
LOWER IN control0.081633
oral cavity0.081238
city0.074667
skin0.074667
state of california0.074534
female0.069565
rural community0.068966
control0.067508
hunter gatherer0.061475
shallow pocket depth0.060241
depth < 3mm0.060241
san diego0.060241
ulcerative colitis0.059642
diarrhea0.057637
pair of nares0.057361
kingdom of spain0.056818
root canal0.049383
venezuela0.049383
amerindian0.049383
age 7-14 years0.048780
late adult stage0.048780
chuquisaca department0.048780
urban biome0.048780
LOWER IN periodontitis0.048485
LOWER IN saliva0.048485
shanghai proper0.047619
age 5-13 years0.047619
bolivia0.046512
hospital0.044444
kingdom of denmark0.043478
periodontitis0.041667
atlanta0.037383
moscow0.037037
age 13-15 years0.037037
periodontal pocket0.037037
india0.036810
clostridium difficile intestinal infectious disease0.036697
egypt0.036697
building0.036364
belgium0.036036
hiv infection0.035714
united kingdom0.035398
russia0.035088
LOWER IN adult0.034483
age 1 year0.033898
LOWER IN feces0.033613
LOWER IN male0.025157
autistic disorder0.025157
LOWER IN nasopharynx0.025157
arm0.025157
tooth0.025000
short bowel syndrome0.025000
age one week0.025000
age<17 years0.025000
estonia0.025000
primary endodontic infection0.025000
root canal infection0.025000
uganda0.025000
pneumonia0.025000
age 50-60 years0.025000
nanning city prefecture0.025000
nephrolithiasis0.025000
bathroom0.025000
shower0.025000
tile0.025000
building wall0.025000
age 3-60.025000
age 130.025000
LOWER IN russia0.025000
glasgow0.025000
cambridgeshire0.025000
age 6 months0.024691
state of nebraska0.024691
zhejiang province0.024691
sinusoidal space0.024691
paranasal sinus0.024691
LOWER IN skin0.024691
mouth neoplasm0.024691
cancer0.024691
newt0.024691
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival plaque0.800000
dentition0.750000
supragingival plaque0.750000
mouth mucosa0.750000
hunter gatherer0.750000
LOWER IN male0.666667
autistic disorder0.666667
root canal0.666667
age < 3 years0.666667
atlanta0.666667
venezuela0.666667
amerindian0.666667
LOWER IN nasopharynx0.666667
arm0.666667
mouth0.571429
finland0.571429
crohn's disease0.555556
child0.521739
amsterdam0.500000
moscow0.500000
bihar state0.500000
visceral leishmaniasis0.500000
age 13-15 years0.500000
age 7-14 years0.500000
autism0.500000
shallow pocket depth0.500000
depth < 3mm0.500000
san diego0.500000
periodontal pocket0.500000
tooth0.500000
severe0.500000
LOWER IN mild0.500000
late adult stage0.500000
short bowel syndrome0.500000
age one week0.500000
obsolete_juvenile stage0.500000
age<17 years0.500000
estonia0.500000
primary endodontic infection0.500000
root canal infection0.500000
gout0.500000
perth0.500000
recurrent otitis media0.500000
middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
uganda0.500000
pneumonia0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
older age0.500000
LOWER IN younger age0.500000
LOWER IN depth > 3mm0.500000
LOWER IN deep pocket depth0.500000
LOWER IN age 2 months0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
caucasian0.500000
LOWER IN african0.500000
LOWER IN african american0.500000
cheek0.500000
age 2-4 years0.500000
chuquisaca department0.500000
drosophila melanogaster0.500000
fruit fly0.500000
age one year0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
salmonella gastroenteritis0.500000
LOWER IN sinusitis0.500000
lower labial mucosa0.500000
buccal mucosa0.500000
teeth braces0.500000
braces0.500000
depth > 3mm0.500000
deep pocket depth0.500000
bathroom0.500000
shower0.500000
tile0.500000
urban biome0.500000
building wall0.500000
LOWER IN kitchen0.500000
LOWER IN sink0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
LOWER IN skin under eye0.500000
pulpitis0.500000
age 3-60.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
train0.500000
boston0.500000
toronto0.500000
LOWER IN age one month0.500000
kitchen0.500000
sink0.500000
gallbladder0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.897436
feces0.410256
adult0.314103
dentition0.205128
mouth0.198718
united states of america0.185897
china0.166667
subgingival plaque0.153846
child0.153846
infant0.102564
brazil0.083333
LOWER IN control0.076923
saliva0.070513
control0.070513
obsolete_juvenile stage0.064103
state of california0.057692
australia0.057692
female0.051282
czech republic0.051282
supragingival plaque0.051282
oral cavity0.044872
city0.044872
finland0.044872
age < 3 years0.044872
crohn's disease0.044872
mouth mucosa0.044872
skin0.044872
rural community0.038462
kingdom of spain0.032051
shallow pocket depth0.032051
depth < 3mm0.032051
san diego0.032051
ulcerative colitis0.032051
diarrhea0.032051
pair of nares0.032051
hunter gatherer0.032051
LOWER IN periodontitis0.025641
shanghai proper0.025641
age 7-14 years0.025641
root canal0.025641
late adult stage0.025641
kingdom of denmark0.025641
hospital0.025641
periodontitis0.025641
LOWER IN saliva0.025641
venezuela0.025641
amerindian0.025641
age 5-13 years0.025641
bolivia0.025641
chuquisaca department0.025641
urban biome0.025641
russia0.019231
moscow0.019231
india0.019231
age 13-15 years0.019231
periodontal pocket0.019231
clostridium difficile intestinal infectious disease0.019231
atlanta0.019231
age 1 year0.019231
egypt0.019231
hiv infection0.019231
belgium0.019231
united kingdom0.019231
building0.019231
LOWER IN adult0.019231
LOWER IN feces0.019231
LOWER IN male0.012821
autistic disorder0.012821
tooth0.012821
south korea0.012821
age 6 months0.012821
short bowel syndrome0.012821
age one week0.012821
age<17 years0.012821
estonia0.012821
state of nebraska0.012821
primary endodontic infection0.012821
root canal infection0.012821
zhejiang province0.012821
uganda0.012821
bronchoalveolar lavage0.012821
bronchial epithelium0.012821
lung0.012821
pneumonia0.012821
age0.012821
mucosa0.012821
sinusoidal space0.012821
paranasal sinus0.012821
nasal cavity0.012821
research facility0.012821
age 50-60 years0.012821
nanning city prefecture0.012821
nephrolithiasis0.012821
mucus0.012821
LOWER IN nasopharynx0.012821
bathroom0.012821
shower0.012821
tile0.012821
building wall0.012821
LOWER IN skin0.012821
Exp. ID User ID Description Date Region Flag Sequences
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
104amnon high in control compared to periodontitis in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 3
570amnon high in visceral leishmaniasis compared to control in homo sapiens feces india bihar state 2019-12-16v3No1 / 4
598amnon high in female compared to male in child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 13
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
95amnonhigh freq. in root canal (dominant homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
284amnondominant homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v4No1 / 18
519amnondominant homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
532amnondominant homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 19
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnondominant homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
278amnondominant homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
96amnondominant homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens czech republic adult 2020-01-09v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnondominant homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
260amnondominant homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 24
554amnondominant homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 24
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v3No1 / 24
532amnoncommon homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 24
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
104amnondominant homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth )2017-10-01v4No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 36
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 42
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 54
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 56
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
576amnoncommon homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
576amnoncommon homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 71
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 79
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in building urban biome united states of america )2017-10-01v4No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
598amnoncommon child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
596amnon high in age 1-7 years compared to age < 1 year in homo sapiens sweden saliva child 2020-03-18v3No1 / 288
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org