Search result for sequence:
TGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGAAGGTAGAAGGCCTACGGGTCATGAACTTCTTTTCCCGGAGAAGAAGCAATGACGGTATCCGGGGAATAAGCATCGGCTAACTCTGTGCCAGCAGCCGCGG
common ontology terms
term enrichment score
TermScore
research facility0.218557
united states of america0.177091
ant0.169154
costa rica0.162741
sus scrofa0.146654
pig0.146654
ileum0.142132
gallus gallus0.128926
chicken0.128926
larval stage0.126582
feces0.121104
glycine max0.114187
farm0.107069
china0.102203
depth 0-20cm0.094421
female organism0.092784
jilin province0.087432
tonsil0.085561
rumen0.084906
digestive system0.084388
LOWER IN caecum0.084359
black soil0.083770
mus musculus0.081800
bos taurus0.079602
state of michigan0.078818
ph 70.077295
stomach0.076312
mouse0.075721
wild0.074419
state of texas0.073107
oncorhynchus mykiss0.067039
rainbow trout0.067039
duodenum0.066593
digesta0.066298
caecum0.066176
fish0.064815
female0.064430
jejunum0.057720
hen0.057307
pseudomyrmex flavicornis0.056497
small intestine0.056497
liolaemus ruibali0.056497
pseudomyrmex nigrocinctus0.056497
kenya0.056497
lushan mountain0.056497
age 6 weeks0.055710
soybean0.054945
forested area0.054945
homo sapiens0.054685
rhizosphere0.053790
argentina0.053476
jiangxi province0.053476
LOWER IN feces0.053191
sweden0.048980
skin0.048019
topsoil0.047170
soil0.046589
fish feed0.046243
alouatta palliata0.046243
mantled howler monkey0.046243
nile tilapia0.045714
cold environment0.045714
pseudomyrmex spinicola0.045714
food product type0.045714
vigna radiata0.045714
mung bean sprouts0.045714
LOWER IN fasting0.045198
india0.045028
adult organism0.045028
oreochromis niloticus0.044693
czech republic0.044199
early timepoints0.043243
LOWER IN late timepoints0.043243
sheep0.042781
LOWER IN colon0.042478
ovis aries0.041885
pregnancy0.041885
male0.041812
control0.038078
adult0.036254
root nodule0.034985
holstein dairy cow0.034985
soy bean0.034682
glycine soja0.034682
england0.034682
12c0.034682
province of alberta0.034682
dermanyssus gallinae0.034682
red poulty mite0.034682
poulty farm0.034682
intestinal contents0.034682
cobb broiler chicken0.034682
holstein-friesian bull0.034682
macaca mulatta0.034682
age 35 weeks0.034682
republic of congo0.034682
nouabale-ndoki national park0.034682
tropical grassland biome0.034682
nanger granti0.034682
gazelle0.034682
Fraction of dbbact annotations with this term covered by the query
TermScore
jejunum0.800000
root nodule0.666667
fish feed0.666667
alouatta palliata0.666667
mantled howler monkey0.666667
hen0.666667
holstein dairy cow0.666667
soy bean0.500000
state of missouri0.500000
ant0.500000
pseudomyrmex flavicornis0.500000
jilin province0.500000
glycine soja0.500000
catfish0.500000
nile tilapia0.500000
small intestine0.500000
liolaemus ruibali0.500000
centris atripes0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
age 6-10 weeks0.500000
pseudomyrmex nigrocinctus0.500000
oncorhynchus mykiss0.500000
england0.500000
rainbow trout0.500000
pseudomyrmex nigropilosus0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
pseudomyrmex spinicola0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
province of alberta0.500000
food product type0.500000
vigna radiata0.500000
producer c10.500000
mung bean sprouts0.500000
guanacaste conservation area0.500000
LOWER IN bronchitis0.500000
LOWER IN infectious bronchitis virus0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
root structure0.500000
intestinal contents0.500000
age 60 weeks0.500000
state of rhode island0.500000
miso food product0.500000
ailurus fulgens0.500000
red panda0.500000
producer c20.500000
ixodes scapularis0.500000
gut content0.500000
LOWER IN ascending colon0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
cyprinus carpio0.500000
common carp0.500000
cobb broiler chicken0.500000
przewalski horse0.500000
acacia ants0.500000
LOWER IN pseudomyrmex gracilis0.500000
LOWER IN generalist0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
short bowel syndrome0.500000
douchi0.500000
rumen solids0.500000
LOWER IN rumen liquid0.500000
holstein-friesian bull0.500000
age 1-3 weeks0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
LOWER IN mucosa0.500000
age 12-19 weeks0.500000
skh-1 hairless mouse0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
LOWER IN age 1-3 weeks0.500000
age 130.500000
age 8 months0.500000
macaca mulatta0.500000
rhesus macaque0.500000
LOWER IN juvenile organism0.500000
dicentrarchus labrax0.500000
ria formosa0.500000
open water pond0.500000
seabass0.500000
LOWER IN ileal mucosa0.500000
age 35 weeks0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
alpine pasture0.500000
LOWER IN lowland pasture0.500000
LOWER IN lowland farm0.500000
milk0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.377246
research facility0.317365
feces0.227545
china0.185629
costa rica0.113772
ant0.101796
sus scrofa0.095808
pig0.095808
larval stage0.089820
soil0.083832
ileum0.083832
farm0.077844
gallus gallus0.077844
chicken0.077844
homo sapiens0.077844
glycine max0.065868
rhizosphere0.065868
depth 0-20cm0.065868
digestive system0.059880
mus musculus0.059880
caecum0.053892
mouse0.053892
female organism0.053892
rumen0.053892
stomach0.047904
ph 70.047904
black soil0.047904
jilin province0.047904
tonsil0.047904
state of michigan0.047904
LOWER IN caecum0.047904
female0.047904
wild0.047904
bos taurus0.047904
state of texas0.041916
fish0.041916
control0.041916
oncorhynchus mykiss0.035928
rainbow trout0.035928
sweden0.035928
male0.035928
digesta0.035928
adult0.035928
duodenum0.035928
pseudomyrmex flavicornis0.029940
soybean0.029940
small intestine0.029940
argentina0.029940
liolaemus ruibali0.029940
pseudomyrmex nigrocinctus0.029940
age 6 weeks0.029940
hen0.029940
jejunum0.029940
LOWER IN feces0.029940
skin0.029940
kenya0.029940
topsoil0.029940
jiangxi province0.029940
forested area0.029940
lushan mountain0.029940
oreochromis niloticus0.023952
nile tilapia0.023952
fish feed0.023952
cold environment0.023952
pseudomyrmex spinicola0.023952
israel0.023952
food product type0.023952
vigna radiata0.023952
mung bean sprouts0.023952
alouatta palliata0.023952
mantled howler monkey0.023952
czech republic0.023952
early timepoints0.023952
LOWER IN fasting0.023952
LOWER IN late timepoints0.023952
LOWER IN control0.023952
LOWER IN colon0.023952
india0.023952
adult organism0.023952
ovis aries0.023952
sheep0.023952
pregnancy0.023952
soy bean0.017964
root nodule0.017964
glycine soja0.017964
state of minnesota0.017964
crematogaster0.017964
monkey0.017964
age 4 weeks0.017964
intestine0.017964
england0.017964
12c0.017964
cecal content0.017964
canada0.017964
male organism0.017964
province of alberta0.017964
dermanyssus gallinae0.017964
red poulty mite0.017964
poulty farm0.017964
intestinal contents0.017964
Exp. ID User ID Description Date Region Flag Sequences
747amnonsoy bean chloroplast (other glycine max, chloroplast, soy bean)2021-03-10v4No1 / 1
747amnondominant in soy bean root nodules (dominant united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 4
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
747amnoncommon in soy bean root nodules (common united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 7
255amnoncommon digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 8
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
271amnondominant rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 9
71amnondominant research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 10
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
59amnondominant digestive system, centris atripes2017-02-03v4No1 / 11
274amnondominant feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 11
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
71amnondominant research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 12
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
396amnondominant digestive system, intestine, oncorhynchus mykiss, england, fish, rainbow trout2018-11-14v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 12
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
587amnondominant israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 15
625amnondominant feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 16
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 16
180amnondominant larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
59amnoncommon digestive system, centris atripes2017-02-03v4No1 / 20
271amnoncommon root structure, glycine max, soybean, depth 0-20cm, root, root nodule, china2018-01-09v4No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
311amnoncommon united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 22
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
587amnondominant israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 23
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 29
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
71amnoncommon research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 33
180amnoncommon adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 36
497amnoncommon feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 39
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
396amnoncommon digestive system, intestine, cyprinus carpio, england, fish, common carp2018-11-14v4No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 47
744amnon high in ileum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 47
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
408amnon high in pseudomyrmex nigrocinctus pseudomyrmex flavicornis pseudomyrmex spinicola acacia ants compared to pseudomyrmex gracilis generalist in united states of america costa rica pseudomyrmex ant 2018-11-22v4No1 / 53
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 59
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 67
587amnoncommon israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 67
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 110
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 120
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 183
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
808amnon high in digesta compared to mucosa ileal mucosa in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 192
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine alpine pasture compared to lowland pasture lowland farm in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 204
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 210
808amnon high in ileum compared to caecum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 224
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
78amnoncommon feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 234
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
781amnoncommon feces, kenya, wild, masai mara national park, madoqua kirkii, kirk's dik-dik2021-04-28v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
78amnonhigher in younger gazelles ( high in age young age compared to old age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 268
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
80amnoncommon feces, state of florida, central america, alouatta palliata, mantled howler monkey2017-03-03v4No1 / 309
625amnoncommon feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 309
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
559amnoncommon feces, united states of america, zoological garden, diceros bicornis, black rhinoceros, captive2019-11-03v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
781amnoncommon feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 400
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 530
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
788amnon high in feces cherokia georgiana georgiana millipede compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 589
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, holstein dairy cow2028-03-09v4No1 / 593
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 614
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
748amnon high in holstein dairy cow compared to jersey cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 638
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 643
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
78amnon high in female compared to male in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 811
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
748amnon high in rumen ruminal fluid compared to feces in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2716
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
676amnon high in fish farm aquarium compared to water inlet in saline water sea water french republic english channel coastal waters of france 2028-02-27v4No1 / 3729
676amnon high in saline water sea water compared to biofilm saline water biofilm in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 4350

Problems / suggestions? Please email info AT dbbact DOT org