Search result for sequence:
TGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATGCCGCGTGGAGGTTAAAGGCCTACGGGTCATAAACTTCTTTTCCTGGAGAAGAAACAATGACGGTATCCGGGGAATAAGCATCGGCTAACTCTGTGCCAGCAGCCGCGG
common ontology terms
term enrichment score
TermScore
medicago sativa0.666667
alfalfa sprouts0.666667
food product type0.666667
producer c10.500000
producer c20.500000
israel0.153846
Fraction of dbbact annotations with this term covered by the query
TermScore
producer c10.500000
medicago sativa0.500000
alfalfa sprouts0.500000
food product type0.500000
producer c20.500000
israel0.083333
Fraction of annotations for the query sequences containing the term
TermScore
medicago sativa1.000000
alfalfa sprouts1.000000
food product type1.000000
israel1.000000
producer c10.500000
producer c20.500000

Problems / suggestions? Please email info AT dbbact DOT org