Search result for sequence:
TGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGTGACGCCGCGTGTGGGACGAAGGCCTTCGGGTCGTAAACCACTGTCAGTGGGAAAGATGGGTGTCGGCGCTAATACCGCCGGCATCTGACGGTACCTGCAGAGGAAGCCCCGG
common ontology terms
term enrichment score
TermScore
flood plain0.388889
sacramento0.388889
cosumnes river preserve0.388889
ultisol0.371429
alabama0.371429
agricultural field0.328502
auburn0.313253
dekalb county0.312500
illinois0.312500
foot slope 0.266667
state of illinois0.212766
alfisol0.185185
hapludalf0.185185
sandy loam0.185185
upland soil0.185185
sandy loam soil0.169492
mollisol0.169492
lund0.153846
clayey till0.153846
late weichselian glaciation0.153846
loam soil0.142857
silt loam0.135135
depth 50-90cm0.120000
kingdom of denmark0.105263
depth (soil) 60-100cm0.083333
depth 108-140cm0.083333
depth 30-50cm0.083333
depth 116-140cm0.083333
depth (soil) 133-166cm0.083333
depth (soil) 100-133cm0.083333
depth 90-100cm0.083333
depth 50-70cm0.083333
depth 12-44cm0.083333
soil0.082040
depth (soil) 30-60cm0.080000
depth 25-50cm0.080000
shanghai proper0.080000
ph>70.080000
clay loam0.080000
agricultural feature0.076923
npk fertilizer0.076923
state of california0.073684
ph 7-80.066667
cultivated environment0.066667
depth 200-350cm0.043478
LOWER IN depth 450-600cm0.043478
depth 166-200cm0.043478
LOWER IN depth 400-700cm0.043478
depth 56-1400.043478
LOWER IN depth 0-560.043478
depth 70-100cm0.043478
depth (soil) 400-700cm0.043478
depth 56-116cm0.043478
LOWER IN depth 15-30cm0.043478
depth 200-260cm0.043478
depth 30-60cm0.043478
LOWER IN depth 0-12cm0.043478
depth 44-108cm0.043478
depth 300-350cm0.043478
depth 27-56cm0.043478
depth (soil) 166-200cm0.043478
depth 70-120cm0.043478
sandy till 0.043478
reservoir0.043478
xiannv lake0.043478
sediment depth 0-10cm0.043478
LOWER IN depth 25-50cm0.042553
LOWER IN depth 10-25cm0.042553
LOWER IN depth 0-30cm0.042553
depth 15-30cm0.042553
heavy metal0.042553
depth 0-30cm0.041667
greenhouse soil0.041667
LOWER IN autumn0.038462
lake0.037736
spring0.035714
farm0.035088
fresh water0.030769
LOWER IN summer0.030303
sediment0.028169
china0.021583
united states of america0.016282
Fraction of dbbact annotations with this term covered by the query
TermScore
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
depth (soil) 60-100cm0.500000
dekalb county0.500000
illinois0.500000
alfisol0.500000
hapludalf0.500000
sandy loam0.500000
depth 108-140cm0.500000
ultisol0.500000
alabama0.500000
foot slope 0.500000
depth 30-50cm0.500000
depth 116-140cm0.500000
depth (soil) 133-166cm0.500000
depth (soil) 100-133cm0.500000
depth 50-90cm0.500000
depth 90-100cm0.500000
depth 50-70cm0.500000
upland soil0.500000
depth 200-350cm0.500000
LOWER IN depth 450-600cm0.500000
lund0.500000
clayey till0.500000
late weichselian glaciation0.500000
depth 166-200cm0.500000
LOWER IN depth 400-700cm0.500000
depth 56-1400.500000
LOWER IN depth 0-560.500000
depth 70-100cm0.500000
depth (soil) 400-700cm0.500000
depth 56-116cm0.500000
LOWER IN depth 15-30cm0.500000
depth 200-260cm0.500000
depth 30-60cm0.500000
depth 12-44cm0.500000
LOWER IN depth 0-12cm0.500000
depth 44-108cm0.500000
depth 300-350cm0.500000
depth 27-56cm0.500000
depth (soil) 166-200cm0.500000
depth 70-120cm0.500000
sandy till 0.500000
reservoir0.500000
xiannv lake0.500000
sediment depth 0-10cm0.500000
depth (soil) 30-60cm0.333333
sandy loam soil0.333333
auburn0.333333
mollisol0.333333
LOWER IN depth 25-50cm0.333333
loam soil0.333333
depth 25-50cm0.333333
LOWER IN depth 10-25cm0.333333
LOWER IN depth 0-30cm0.333333
depth 15-30cm0.333333
shanghai proper0.333333
ph>70.333333
clay loam0.333333
heavy metal0.333333
agricultural field0.285714
depth 0-30cm0.250000
agricultural feature0.250000
npk fertilizer0.250000
greenhouse soil0.250000
state of illinois0.200000
silt loam0.166667
kingdom of denmark0.125000
ph 7-80.125000
cultivated environment0.125000
LOWER IN autumn0.125000
lake0.111111
spring0.083333
fresh water0.047619
LOWER IN summer0.045455
soil0.043011
state of california0.041667
sediment0.037037
farm0.028571
china0.012821
united states of america0.008264
Fraction of annotations for the query sequences containing the term
TermScore
soil0.886364
united states of america0.545455
agricultural field0.386364
state of california0.318182
flood plain0.318182
sacramento0.318182
cosumnes river preserve0.318182
ultisol0.295455
auburn0.295455
alabama0.295455
state of illinois0.227273
dekalb county0.227273
illinois0.227273
foot slope 0.181818
sandy loam soil0.113636
alfisol0.113636
hapludalf0.113636
sandy loam0.113636
mollisol0.113636
silt loam0.113636
upland soil0.113636
kingdom of denmark0.090909
lund0.090909
loam soil0.090909
clayey till0.090909
late weichselian glaciation0.090909
depth 50-90cm0.068182
china0.068182
depth (soil) 30-60cm0.045455
depth (soil) 60-100cm0.045455
depth 108-140cm0.045455
depth 30-50cm0.045455
depth 116-140cm0.045455
depth (soil) 133-166cm0.045455
depth (soil) 100-133cm0.045455
depth 90-100cm0.045455
depth 50-70cm0.045455
depth 25-50cm0.045455
depth 12-44cm0.045455
agricultural feature0.045455
farm0.045455
shanghai proper0.045455
ph>70.045455
ph 7-80.045455
npk fertilizer0.045455
clay loam0.045455
cultivated environment0.045455
LOWER IN depth 25-50cm0.022727
depth 200-350cm0.022727
LOWER IN depth 450-600cm0.022727
depth 166-200cm0.022727
LOWER IN depth 400-700cm0.022727
depth 56-1400.022727
LOWER IN depth 0-560.022727
LOWER IN depth 10-25cm0.022727
depth 70-100cm0.022727
depth (soil) 400-700cm0.022727
depth 56-116cm0.022727
LOWER IN depth 15-30cm0.022727
depth 200-260cm0.022727
depth 30-60cm0.022727
LOWER IN depth 0-30cm0.022727
LOWER IN depth 0-12cm0.022727
depth 44-108cm0.022727
depth 300-350cm0.022727
depth 27-56cm0.022727
depth (soil) 166-200cm0.022727
depth 0-30cm0.022727
depth 70-120cm0.022727
sandy till 0.022727
depth 15-30cm0.022727
greenhouse soil0.022727
spring0.022727
LOWER IN summer0.022727
LOWER IN autumn0.022727
lake0.022727
sediment0.022727
fresh water0.022727
heavy metal0.022727
reservoir0.022727
xiannv lake0.022727
sediment depth 0-10cm0.022727
Exp. ID User ID Description Date Region Flag Sequences
786sheryoDominant in flood plain soil near cosumnes river, california, at 30-60cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 3
786sheryoDominant in flood plain soil near cosumnes river, california, at 60-100cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 5
829sheryoDominanmt in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 8
786sheryoDominant in flood plain soil near cosumnes river, california, at 166-200cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 9
823sheryoDominant at 30-50cm depth in foot slope ultisol soil in auburn, alabama (dominant soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 30-50cm)2021-08-08v3No1 / 10
829sheryoDominant in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 10
786sheryoDominant in flood plain soil near cosumnes river, california, at 133-166cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 12
786sheryoDominant in flood plain soil near cosumnes river, california, at 100-133cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 14
823sheryoDominant at 50-90cm depth in foot slope ultisol soil in auburn, alabama (dominant soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 50-90cm)2021-08-08v3No1 / 17
823sheryoDominant at 90-100cm depth in foot slope ultisol soil in auburn, alabama (dominant soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 18
823sheryoHigher in 50-70cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 25-50cm in soil agricultural field ultisol upland soil auburn alabama )2021-08-07v3No1 / 135
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 197
786sheryoHigher at 166-200cm depth compared to 400-700cm depth in flood plain soil near cosumnes river, california ( high in depth 166-200cm compared to depth 400-700cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 206
829sheryoHigher soil depth of 56-140cm compared to soil depth 0-56cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 56-140 compared to depth 0-56 in united states of america soil state of illinois mollisol silt loam dekalb county illinois )2021-08-26v3No1 / 249
823sheryoHigher in 25-50cm depth compared to 10-25cm depth in ultisol soil in auburn, alabama ( high in depth 25-50cm compared to depth 10-25cm in soil agricultural field ultisol upland soil auburn alabama )2021-08-07v3No1 / 283
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 70-100cm)2021-08-07v3No1 / 459
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 481
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 56-116cm)2021-08-26v3No1 / 491
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 516
823sheryoHigher at 50-90cm depth compared to 15-30cm depth in foot slope ultisol soil in auburn, alabama ( high in depth 50-90cm compared to depth 15-30cm in soil agricultural field ultisol auburn alabama foot slope )2021-08-08v3No1 / 539
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 50-70cm)2021-08-07v3No1 / 620
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, upland soil, auburn, alabama, depth 25-50cm)2021-08-07v3No1 / 652
786sheryoHigher at 30-60cm depth compared to 0-30cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth 0-30cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 675
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 692
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 721
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 30-50cm)2021-08-08v3No1 / 753
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 90-100cm)2021-08-08v3No1 / 782
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, foot slope , depth 50-90cm)2021-08-08v3No1 / 815
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 27-56cm)2021-08-26v3No1 / 906
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 166-200cm)2021-05-18v3No1 / 936
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, depth 0-30cm, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 15-30cm, foot slope )2021-08-08v3No1 / 1218
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to summer autumn in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 1962

Problems / suggestions? Please email info AT dbbact DOT org