Search result for sequence:
TGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGGAACGAAAAAGCTCCTTCTAATACAGGGGGCCCATGACGGTACCGTAAGAATAAGCACCGGC
common ontology terms
term enrichment score
TermScore
skin0.229008
united states of america0.184267
costa rica0.132797
digestive system0.122180
southern united states0.113924
homo sapiens0.110880
snake0.107784
canis lupus familiaris0.106667
research facility0.106562
australia0.098495
germany0.095238
intestine0.087912
butterfly0.086957
tick0.080537
newt0.080537
pair of nares0.075949
body proper0.071856
nasopharynx0.070588
soil0.070588
cambridgeshire0.066667
mucus0.065934
adult0.065934
china0.061224
air0.059701
whole body0.057143
dog0.056338
canada0.054795
city0.054054
united kingdom0.054054
hong kong0.054054
beagle dog0.054054
nasal wash0.054054
state of rhode island0.054054
urocyon littoralis catalinae0.054054
santa catalina island fox0.054054
santa catalina island0.054054
urocyon littoralis0.054054
nasal cavity0.053333
frog0.053097
sinusoidal space0.052632
paranasal sinus0.052632
mucosa0.051282
food (fermented)0.051282
rhizosphere0.051282
fish0.050420
leaf0.050000
brazil0.047059
water0.043796
lissotriton vulgaris0.041096
cannabis sativa0.041096
fossorial snake0.041096
austria0.041096
ensete ventricosum0.041096
ethiopian banana0.041096
days 30-600.041096
anaerobic fermentation0.041096
amphibia0.041096
pomacea canaliculata0.041096
golden apple snail0.041096
nanheng river0.041096
qingpu district0.041096
pond0.041096
urine0.040678
bronchial epithelium0.040678
farm0.040404
bronchoalveolar lavage0.040268
soybean0.040268
french republic0.039867
sea water0.039604
sinusitis0.039474
root endosphere0.039474
ethiopia0.039474
late timepoint0.039474
glycine max0.039474
stomach0.038961
LOWER IN wild0.038710
LOWER IN saliva0.038339
control0.038217
LOWER IN feces0.037975
wild0.037037
depth 0-20cm0.036585
root0.032432
LOWER IN control0.028169
graz city district0.027972
salamander0.027972
whole plant0.027972
toad0.027972
subway0.027778
yellowstone national park0.027778
ixodes antechini0.027778
propagation stage0.027778
hydrothermal vent0.027778
greece0.027778
marine hydrothermal vent0.027778
volcanic rock0.027778
volcanic crater0.027778
active vent0.027778
bronchial brush0.027778
coarse-loamy soil0.027778
day 120.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
tick0.666667
newt0.666667
canada0.666667
graz city district0.666667
salamander0.666667
whole plant0.666667
toad0.666667
pyrisitia nise0.500000
mimosa yellow butterfly0.500000
eurema albula0.500000
ghost yellow butterfly0.500000
ixodes fecialis0.500000
aphrissa boisduvalii0.500000
haemaphysalis humerosa0.500000
ant0.500000
pseudomyrmex cubaensis0.500000
hong kong0.500000
subway0.500000
yellowstone national park0.500000
chlosyne gaudialis0.500000
perth0.500000
recurrent otitis media0.500000
middle ear fluid0.500000
LOWER IN middle ear rinse0.500000
beagle dog0.500000
ixodes ornithorhynchi0.500000
ixodes antechini0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
nasal wash0.500000
parkinson's disease0.500000
LOWER IN days 0-30.500000
days 57-600.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
ixodes scapularis0.500000
LOWER IN pixr immunized0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
propagation stage0.500000
cannabis sativa0.500000
arawacus togarna0.500000
contact lens0.500000
rem sleep behavior disorder0.500000
nasal brush0.500000
southern united states0.500000
diadophis punctatus0.500000
ringneck snake0.500000
fossorial snake0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
east antarctica0.500000
nunatak0.500000
depth 2cm0.500000
mimelia0.500000
carphophis amoenus0.500000
worm snake0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
nasal cavity mucosa0.500000
austria0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
LOWER IN inactive vent0.500000
anoplophora glabripennis0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
temp 20c0.500000
LOWER IN temp 10c0.500000
cadmium0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
coarse-loamy soil0.500000
day 120.500000
LOWER IN day 10.500000
bermuda0.500000
porites astreoides0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
coluber constrictor0.500000
eastern racer snake0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.414286
homo sapiens0.178571
skin0.171429
research facility0.135714
digestive system0.092857
adult0.085714
costa rica0.078571
canis lupus familiaris0.071429
china0.071429
australia0.064286
snake0.064286
southern united states0.064286
germany0.057143
soil0.057143
intestine0.057143
butterfly0.050000
tick0.042857
body proper0.042857
nasopharynx0.042857
control0.042857
newt0.042857
pair of nares0.042857
whole body0.035714
air0.035714
city0.035714
cambridgeshire0.035714
united kingdom0.035714
dog0.035714
water0.035714
mucus0.035714
rhizosphere0.035714
mucosa0.028571
sinusoidal space0.028571
paranasal sinus0.028571
LOWER IN control0.028571
hong kong0.028571
beagle dog0.028571
nasal wash0.028571
canada0.028571
farm0.028571
nasal cavity0.028571
sea water0.028571
fish0.028571
state of rhode island0.028571
food (fermented)0.028571
leaf0.028571
urocyon littoralis catalinae0.028571
santa catalina island fox0.028571
santa catalina island0.028571
wild0.028571
urocyon littoralis0.028571
frog0.028571
brazil0.028571
sinusitis0.021429
stomach0.021429
bronchoalveolar lavage0.021429
LOWER IN wild0.021429
lissotriton vulgaris0.021429
root0.021429
root endosphere0.021429
cannabis sativa0.021429
fossorial snake0.021429
urine0.021429
austria0.021429
feces0.021429
bronchial epithelium0.021429
LOWER IN saliva0.021429
ethiopia0.021429
ensete ventricosum0.021429
ethiopian banana0.021429
late timepoint0.021429
days 30-600.021429
anaerobic fermentation0.021429
amphibia0.021429
pomacea canaliculata0.021429
golden apple snail0.021429
nanheng river0.021429
qingpu district0.021429
french republic0.021429
pond0.021429
LOWER IN feces0.021429
depth 0-20cm0.021429
glycine max0.021429
soybean0.021429
contamination0.014286
subway0.014286
yellowstone national park0.014286
geothermal field0.014286
sediment0.014286
LOWER IN water0.014286
high temperature environment0.014286
child0.014286
ixodes antechini0.014286
larval stage0.014286
seedling0.014286
propagation stage0.014286
state of california0.014286
grape0.014286
vitis vinifera0.014286
stem0.014286
Exp. ID User ID Description Date Region Flag Sequences
605amnoncandidate contaminant (high in negative controls) (contamination)2020-04-07v3No1 / 0
501amnoncommon costa rica, butterfly, digestive system, pyrisitia nise, mimosa yellow butterfly2019-03-08v4No1 / 5
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 5
621amnoncommon ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 5
501amnoncommon costa rica, butterfly, digestive system, aphrissa boisduvalii2019-03-08v4No1 / 6
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 7
621amnoncommon haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 7
607amnonhigher in blanks compared to nasopharyngeal samples (contamination)2020-04-19v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 9
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 10
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v4No1 / 10
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 12
605amnon high in middle ear fluid compared to middle ear rinse in australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v3No1 / 12
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v4No1 / 13
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 14
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 14
621amnoncommon ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 15
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 15
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 16
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 16
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 16
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 18
621amnoncommon tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 18
614amnonincreases in picher plant fluid grown in lab ( high in research facility days 57-60 late time points compared to wild days 0-3 early time points in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 19
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 19
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 19
618amnondominant canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 20
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 20
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 22
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 24
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 25
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 25
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 26
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 30
527amnoncommon soil, antarctica, east antarctica, nunatak, depth 2cm, mimelia2019-07-14v4No1 / 32
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 34
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 35
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 36
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 36
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 37
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 38
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 39
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 42
618amnoncommon canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 44
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 46
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 54
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 56
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 )2020-03-27v4No1 / 59
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 60
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 61
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 63
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 65
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 67
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 68
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 73
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 76
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 79
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 79
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 80
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 83
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 83
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 84
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 84
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 85
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 85
9amnoncommon bermuda, sea water2016-10-27v4No1 / 90
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 91
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 93
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 95
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 100
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 100
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 105
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 105
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 112
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 114
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 117
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 120
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 122
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 123
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 126
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 128
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 132
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 134
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 135
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 135
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 139
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 143
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 145
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 146
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 149
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 150
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 156
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 157
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 160
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 170
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 175
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 183
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 193
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 194
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 195
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 199
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 200
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 235
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 239
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 240
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 266
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 272
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 297
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 307
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 323
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 327
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 364
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 373
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 378
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 470
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 489
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 509
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 509
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 621
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 749
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 889
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 965
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1174
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1228
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1419
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1458
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7953

Problems / suggestions? Please email info AT dbbact DOT org