Search result for sequence:
TTCCAGCTCCAATAGCGTATACTAAAATTGTTGCGGTTAAAAAGCTCGTAGTTGCATTTGTGCGCCGCGCTGTCGGTGCACCGCATCCGCGGTGATACTGACACGTCTGCGGAGCATATCGTCGGTGAGCCGGCGGTAAAACGCCGGTTC
common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon digestive system, costa rica, butterfly, aeria eurimedia2019-03-09v4No1 / 1
118amnoncommon pupa, body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem2017-04-11v4No1 / 4
118amnoncommon in captive raised teneral adult butterfly (common body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 6
118amnondominant pupa, body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem2017-04-11v4No1 / 6
501amnondominant digestive system, costa rica, butterfly, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 7
501amnoncommon digestive system, costa rica, butterfly, marpesia merops2019-03-09v4No1 / 7
501amnoncommon digestive system, costa rica, butterfly, marpesia petreus, ruddy daggerwing butterfly2019-03-08v4No1 / 8
501amnondominant digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 8
118amnonhigh freq. in captive raised teneral adult butterfly (dominant body proper, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, teneral adult, forest ecosystem)2017-04-11v4No1 / 9
501amnondominant digestive system, costa rica, butterfly, aeria eurimedia2019-03-09v4No1 / 9
501amnoncommon digestive system, costa rica, butterfly, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
501amnoncommon digestive system, costa rica, butterfly, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnoncommon digestive system, costa rica, butterfly, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 11
501amnondominant digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
118amnoncommon in captive reared butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 12
501amnoncommon digestive system, costa rica, butterfly, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
501amnoncommon digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 13
118amnoncommon in wild butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
501amnondominant digestive system, costa rica, butterfly, chlosyne gaudialis2019-03-09v4No1 / 14
118amnonhigh freq. in wild butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
501amnoncommon digestive system, costa rica, butterfly, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
501amnoncommon digestive system, costa rica, butterfly, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in digestive system costa rica butterfly )2019-03-09v4No1 / 64

Problems / suggestions? Please email info AT dbbact DOT org